MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

ADEN

The adeN gene encodes a TetR-type transcriptional regulator of the adeIJK efflux system.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3697384/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Drug and biocide RND efflux regulator

Sequences

Download Sequences

>>MEG_701|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|ADEN
ATGCATGATCCAGTCCTTGAGTCACATCATCTCGTATGTGAGAAACCCCAAACACGCCGCGGTATAGAACGTCGTTTAGC
TCTATTGCTAAGCGCAACCGAGCTGTTTTTGGAAAAAGGATATGATGCTGTCTCTCTTGACGACATCGTTAATCATGCTG
GTGGTTCAAAAACCTCTATTTATAAATACTTTGGTAATAAAGATGGCTTATTTACTGCAATCTGCGATTATCGCCGTGAA
ATGTTTTTTAAAGATATCTGTATTGCATTTCAACCAGAGCAAACTTCTTTAAAAGATTATTTAATCCAAACTCTCATCCG
TTTTTATAAGCACATTATTCAACCTGAACATATTGCCTTTTTACGTTTAGTTATTGAACAAACTCAATGTAATGCAACTT
TGAGCCAATACTTATATGAAAAGTGTGCTCTGGATGTCCAAAATACAATTGCTCAAGCCTTACTCATATCTCATCAATCA
GGTGAAATTACCTGTACATCTCCTGATCATTCCTCTCTTATGTATTTTGGAATTTTACGTGATATTGAATGGCGAATGAT
TATGGGAATGCCTCTCCCACCTAATGAAACAGAAGTCATTGATTATATTAACTATTGTGTTGATATTTTCTTAAAGGGCC
ATCATAAAGTCTAA

>>MEG_702|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_regulator|ADEN
ATGCATGATCCAGTCCTTGAGTCACATCATCTCGTATGTGAAAAACCCCAAACACGCCGCGGTATAGAACGTCGTTTAGC
TCTATTGCTAAGCGCAACCGAGCTGTTTTTGGAAAAAGGATATGATGCTGTCTCTCTTGACGACATCGTTAATCATGCTG
GTGGTTCAAAAACCTCTATTTATAAATACTTCGGTAATAAAGATGGCTTATTTACTGCAATCTGCGATTATCGCCGTGAA
ATGTTTTTTAAAGATATCTGCATTGCATTTCAACCAGAGCAAACTTCTTTAAAAGATTATTTAATCCAAACTCTCATCCG
TTTTTATAAGCCCTTTATTCAACCTGAACACATTGCCTTTTTACGTTTGGTTATTGAACAAACTCAATGTAATGCAACTT
TGAGCCAATACTTATATGAAAAATGTGCTCTGGATGTCCAAAATACAATTGCTCAAGCCTTACTCATATCTCATCAATCA
GGTGAAATTACCTGTACATCTCCTGATCATTCCTCTCTTATGTATTTTGGAATTTTACGTGATATTGAATGGCGAATGAT
TATGGGAATGCCTCTCCCACCCAATGAGACAGAAGTTATTGATTATATTAATTATTGTGTTGATATTTTCTTAAAGGGGC
ATCATAAAGTCTAA