Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

MEXE

The mexEF genes encode a multi-drug efflux system under regulation of MexT.

References

  • http://www.sciencedirect.com/science/article/pii/S0006291X14009711

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Drug and biocide RND efflux pumps

Sequences

Download Sequences

>>MEG_3908|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_pumps|MEXE
ATGGATCACTCACTCAAACCCTTGCGCTTCCCGCTCGCTGCCCTGGCAGTGGTGGTGCTCAGCGCTTGCGGTCGCACCCC
CGACGCCGTGCAGGCTCCCGCCGCGCCCAAGGTCAGCGTAGCCAAGGTGATCGAGCAACCGATCAACGAATGGGACGAGT
TCACCGGCCGCCTCGAGGCGCCGGAAACCGTCGAGGTGCGCCCGCGCGTCTCCGGCCAGATCGACCAGGTGGCCTTCACC
GAAGGCGCCCAGGTCAAGAAAGGCGACCTGCTGTTCCAGATCGACCCGCGCCCGTTCCAGGCTGAAGTTCGCCGCCTCGA
AGCCCAACTGCAACAAGCCAAGGCCACCGCCGTGCGCAGCGCCAACGAAGCCAGCCGTGGCGAGCGTCTGCGCGACAGCA
ACGCCATCTCCGCGGAGCTGGCCGAGTCGCGCACCAGCGCCGCCGCCGAGGCCCGCGCCGGGGTCGACGCGATCCAGGCA
CAGCTCGACCTGGCCCGCCTGAACCTGAGCTTCACCCGCGTCACCGCGCCCATCAGCGGCCGCGTCAGCCGCGCCCAGTT
CACCGCCGGCAACATCGTCACGGCCGATGTCACCCCGCTGACCAGCGTGGTTTCCACCGACAAGGTGTACGCCTACTTCG
ACGCCGACGAGCGCGTGTACCTCAAGTACAGCCAGCTCGCCCGCGACGGCCAGCGCGGCCAGAGCACCCCGGTGTACCTG
GGCCTGACCAACGAAACCGGCAACCCGCACCTGGGCCAGATGAACTTCGTCGACAACCAGGTCAACCCGCGCACCGGCAC
CATCCGTGGCCGCGCCGTGTTCGACAACCGCGACGGCCAGTTCACCCCAGGCCTGTACGCACGCCTGAAGCTGGTCGGCA
GCGCCCAGTACGACGCCGTGCTGATCAACGACGAAGCGGTCGGCACGGACCTTGGCAAGAAGTTCGTGCTGGTGATGGAC
AAGGACAACAAGGCCGCCTACCGCGCCGTGGAACTGGGGCCCAAGCTCGAAGGCCTGCGCATCGTGCGCAGCGGCCTGGG
CAAGGATGACCGCATCGTGGTCAAGGGCCTGCAGCGCGTGCGCCCTGGCTCGCCGGTCACCCCGGAGGAAACGCCGATGG
CCAGCGAGCAGACCCTCGCCGCCCTCGCCCAGCAGCGCCAGGCCCTGGAGGCCAGCAACCCGGCGCCGAAAGTGGCCGGC
ACCAATGAAAAAGTCGCCAGCGCCCAGGCGCCGCGCGGTTAA

>>MEG_3909|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_pumps|MEXE
ATGGAACAGTCATCCCACTTCTCCTGGCGCTACCCCCTCGCACTCGCGGCCGTACTGGTCCTGAGCGCCTGCGGCAAGGC
CCCGGAAACCACCCAAGGCATGGCGGCGCCCAAGGTCAGCGTCGCCGAAGTCATCGAACAACCGCTGAACGAGTGGGACG
AATTCACCGGCCGCCTGGAGGCCCCGGAGTCGGTGGAGCTGCGCCCGCGGGTGTCGGGCTACATCGACCGCGTGGCCTTC
CATGAAGGCGCACTGGTGAAGAAAGGCGACCTGCTGTTCCAGATCGACCCGCGCCCGTTCGAGGCCGAGGTCAAGCGCCT
CGAAGCCCAGCTGCAACAGGCCCGCGCGGCCCAGGCGCGGAGCGTCAACGAAGCCCAGCGCGGCGAACGCCTGCGCGCCA
GCAACGCGATCTCCGCGGAACTCGCCGACGCCCGCACCACCGCCGCCCAGGAAGCCAAGGCGGCGGTCGCCGCGACCCAG
GCGCAACTGGACGCGGCGCGCCTGAACCTGAGCTTCACCCGGATCACCGCGCCGATCGACGGTCGCGTCAGCCGCGCCGA
GGTCACCGCCGGCAACCTGGTCAACTCCGGGGAGACCCTGCTCACCACCCTGGTCAGCACCGACAAGGTCTACGCCTACT
TCGACGCCGACGAGCGCGTGTTCCTCAAGTACGTCGAGCTGGCCCGCCAGGCCGGTCGCGACACGCGCAGCGAGAGCCCG
GTGTACCTCGGCCTGAGCAGCGAGGACGGCAACCCGCACCTGGGCCGGCTGGACTTCCTCGACAACCAGGTCAACCCGCG
TACCGGCACCATCCGCGGCCGCGCCGTGTTCGACAACGCCAAGGGCGAGTTCACCCCGGGCCTCTACGTGCGCCTGAAGC
TGGTCGGCAGCAAGACCTACGCCGCCACCCTGATCAAGGACGAAGCGGTCGGCACCGACCTGGGCAAGAAGTTCGTGCTG
GTCCTGGATGGCGACAACAAGACCGTCTACCGCACCGTCGAGATGGGACCGAAGCTGGAGGGCCTGCGCATCGTCCGCAG
CGGCCTGAGCAAGGGCGACCGGATCGTCGTGAATGGCCTGCAGCGGGTCCGCCCGGGCATGCAGGTGGATCCGCAGAAGG
TCGAGATGGCCAGCGCCGACACCCTGGCCACCCTCGCGCGCCTGCGGCAGTCGGTCGGCGACAGCGAACCACCGAAGGTG
GCGGCGTCCAAGGACAACGCCACTCGCAACGAGCCGCGCGGCTGA

>>MEG_3910|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_RND_efflux_pumps|MEXE
ATGTCATTTTCCCGCAAACAGTTTGCACTGTCTGCCATCTTTGTCGCTATTTTAGCAACCGGTGGCAGTTTTATGTTGTT
ACATGAAAATGCCGATGCAAAAGCTGCACCAACCGCTGCCCAACAAGCTGCTACTGTTGATGTAGCCCCAGTAGTAAGCA
AAACCATTACCGATTGGCAAGAATATTCCGGTCGTTTAGAAGCAATTGATCAAGTTGATATTCGACCTCAAGTTTCAGGA
AAACTCATTGCCGTACATTTCAAAGATGGAAGCCTCGTTAAAAAAGGTGATTTACTTTTCACAATCGACCCTCGTCCTTT
TGAAGCAGAACTGAACCGTGCAAAAGCCCAGCTTGCTTCAGCTGAAGCACAGGTAACATATACCGCAAGCAATCTTTCGC
GTATTCAACGTCTCATTCAGAGTAATGCTGTTTCTCGCCAAGAACTGGATTTAGCCGAAAATGATGCACGTTCAGCCAAT
GCTAACCTGCAAGCCGCTAGAGCTGCTGTCCAATCTGCACGTTTAAATCTGGAATACACCCGTATTACTGCACCAGTCAG
CGGCCGGATTTCACGAGCTGAAGTCACCGTTGGTAATGTAGTTTCTGCAGGTAACGGCGCACAGGTTTTAACAAGTTTAG
TGTCTGTATCACGCCTATACGCATCTTTCGATGTTGATGAACAAACTTACCTGAAATATATCAGTAATCAGCGCAATTCT
TCGCAAGTACCTGTCTATATGGGACTTGCCAATGAAACAGGCTTTACTCGCGAAGGTACAATCAACTCAATCGATAACAA
CCTGAATACAACCTCAGGTACGATTCGTGTTCGCGCAACTTTTGACAATCCAAACGGCGTTTTATTACCGGGCCTATATG
CACGAATTCGTTTAGGTGGAGGCCAACCTCGACCAGCGATTCTGATTAGTCCAACCGCGGTTGGTGTCGACCAAGATAAA
CGTTTTGTCGTAGTAGTTGATGCGAAAAATCAAACTGCTTATCGCGAAGTAAAACTCGGTGCCCAACAAGATGGCTTGCA
AATCGTAAATAGCGGATTACAAGCGGGTGATCGTATTGTAGTGAATGGTTTACAGCGAATTCGTCCGGGTGACCCTGTTA
CACCGCATCTCGTTCCTATGCCAAATTCACAAATCACTGCTAACGCTACTCCTCAACCTCAGCCAACAGATAAAACATCA
ACTCCGGCAAAAGGTTAA