MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

NORB

The norB gene encodes a multi-drug efflux pump that is independent of norA. It can act on fluoroquinolones, therefore causing resistance.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/23928023

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Drug and biocide MFS efflux pumps

Sequences

Download Sequences

>>MEG_4210|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|NORB
ATGGAAAAGCCGTCAAGAGAGGCATTTGAAGGCAATAATAAGTTGTTAATAGGAATTGTTTTAAGTGTAATAACGTTTTG
GCTATTTGCACAATCATTGGTTAATGTTGTACCAATACTTGAAGATAGTTTCAATACAGATATTGGAACGGTTAATATCG
CCGTTAGTATAACTGCTTTATTTTCAGGAATGTTTGTAGTAGGAGCAGGTGGTCTTGCTGATAAATATGGCAGAATTAAA
CTCACGAACATTGGTATTATCTTAAATATATTGGGTTCATTATTAATCATTATTTCAAATATTCCTTTATTACTTATTAT
AGGAAGATTAATTCAAGGACTTTCAGCAGCATGTATTATGCCTGCAACTTTGTCTATTATTAAGTCATATTACATTGGGA
AAGATAGACAACGCGCTTTAAGTTATTGGTCAATTGGCTCATGGGGCGGCTCTGGTGTTTGTTCATTTTTTGGAGGTGCA
GTTGCAACGCTTTTAGGTTGGCGTTGGATTTTCATCCTATCAATTATAATTTCATTAATTGCGCTTTTTCTTATTAAAGG
CACACCTGAAACTAAATCTAAATCGATTTCTCTAAATAAATTTGACATTAAAGGTCTGGTTCTTTTAGTCATTATGCTTC
TCAGTTTAAATATTTTAATTACTAAAGGATCAGAATTAGGTGTTAGCTCACTTCTTTTTATCACTTTATTAGCAATTGCA
ATTGGATCTTTTAGTTTATTTATAGTTCTTGAAAAGCGTGCTACAAATCCTTTAATCGATTTTAAATTATTTAAAAATAA
AGCTTACACAGGTGCAACAGCTTCAAACTTTTTGTTAAATGGTGTTGCAGGAACATTAATAGTAGCCAACACATTTGTTC
AAAGAGGTTTAGGATATTCTTCATTGCAAGCAGGAAGTTTATCAATCACTTATTTAGTAATGGTACTAATTATGATTCGT
GTTGGTGAAAAGTTACTTCAAACACTCGGATGCAAGAAACCAATGTTAATTGGAACAGGAGTTCTTATTGTCGGAGAATG
TCTCATTTCATTAACTTTCTTGCCAGAAATATTGTATGTCATTTGTTGTATTATAGGTTATTTATTCTTTGGTTTAGGAC
TAGGGATATATGCTACACCATCAACAGATACAGCAATTGCAAATGCACCGTTAGAAAAAGTAGGCGTTGCTGCAGGTATC
TATAAAATGGCTTCTGCATTAGGTGGAGCATTTGGCGTCGCATTGAGTGGTGCAGTATATGCAATCGTATCAAATATGAC
AAACATTTATACAGGTGCAATGATTGCATTATGGTTAAATGCAGGTATGGGAATATTATCATTCGTTATCATTTTGTTAC
TTGTGCCTAAACAAAACGACACTCAATTATGA