MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

MDTH

The mdtH gene encodes a putative multi-drug efflux system in Escherichia coli.

References

  • http://www.ncbi.nlm.nih.gov/nuccore/U00096?from=1124118&to=1125326&sat=4&sat_key=1

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Drug and biocide MFS efflux pumps

Sequences

Download Sequences

>>MEG_3755|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|MDTH
ATGTCCCGCGTGTCGCAGGCGAGGAACCTGGGTAAATATTTCCTGCTCATCGATAATATGCTGGTCGTGCTGGGGTTCTT
TGTTGTCTTCCCGCTGATCTCTATCCGCTTCGTTGATCAAATGGGCTGGGCCGCCGTCATGGTCGGTATTGCTCTCGGTC
TACGCCAATTTATTCAGCAAGGTCTGGGTATTTTCGGCGGTGCAATTGCCGACCGCTTTGGTGCCAAACCGATGATTGTT
ACCGGTATGCTGATGCGCGCCGCCGGATTCGCCACAATGGGTATCGCCCACGAACCGTGGCTATTGTGGTTTTCATGCCT
GCTCTCGGGACTCGGTGGCACGTTGTTTGATCCGCCGCGTTCGGCGCTGGTGGTGAAATTAATCCGTCCACAGCAGCGTG
GTCGTTTTTTCTCGCTGTTGATGATGCAGGACAGTGCCGGTGCGGTCATTGGCGCATTGTTGGGGAGCTGGCTGTTGCAA
TACGACTTTCGCCTGGTCTGCGCCACAGGGGCAGTTCTATTTGTGCTATGTGCGGCGTTCAATGCGTGGTTGTTACCAGC
ATGGAAACTCTCCACCGTACGCACGCCCGTTCGCGAAGGCATGACCCGCGTGATGCGTGACAAGCGTTTTGTCACCTATG
TTCTGACGCTGGCGGGTTACTACATGCTGGCTGTACAAGTGATGCTGATGCTGCCAATTATGGTCAACGACGTGGCTGGC
GCGCCCTCTGCCGTTAAATGGATGTATGCCATTGAAGCGTGTCTGTCGTTAACGTTGCTCTACCCTATCGCCCGCTGGAG
TGAAAAGCATTTTCGTCTGGAACACCGGTTGATGGCTGGGCTGTTGATAATGTCATTAAGCATGATGCCGGTGGGCATGG
TCAGCGGCCTGCAACAACTTTTCACCCTGATTTGTCTGTTTTATATCGGGTCGATCATTGCCGAGCCTGCGCGTGAAACC
TTAAGTGCTTCGCTGGCGGACGCAAGAGCTCGCGGCAGCTATATGGGGTTTAGCCGTCTGGGTCTGGCGATTGGCGGCGC
TATTGGTTATATCGGTGGCGGCTGGCTGTTTGACCTGGGCAAATCGGCGCACCAGCCAGAGCTTCCGTGGATGATGCTGG
GCATTATTGGCATCTTCACTTTCCTTGCGCTGGGTTGGCAGTTTAGCCAGAAACGCGCCGCGCGTCGTTTGCTTGAACGC
GACGCCTGA