MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

MDTG

Also known at yceE, the mdtG gene encodes a putative efflux pump in Escherichia coli that is overexpressed in resistant strains.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/20008776

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Drug and biocide MFS efflux pumps

Sequences

Download Sequences

>>MEG_3753|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|MDTG
ATGTCACCCTGTGAAAATGACACCCCTATAAACTGGAAACGAAACCTGATCGTCGCCTGGCTAGGCTGTTTTCTTACCGG
TGCCGCCTTCAGTCTGGTAATGCCCTTCTTACCCCTCTACGTTGAGCAGCTTGGCGTTACCGGTCACTCCGCCCTGAATA
TGTGGTCCGGTATTGTCTTCAGCATTACATTTTTATTTTCGGCCATCGCCTCACCGTTTTGGGGTGGACTCGCCGACCGT
AAAGGCCGAAAACTCATGCTATTACGCTCTGCCCTCGGCATGGGCATCGTGATGGTGTTGATGGGGCTGGCACAAAATAT
CTGGCAGTTTTTGATCCTGCGGGCGCTTCTTGGGTTACTTGGCGGATTTGTCCCCAACGCTAATGCTCTTATCGCCACAC
AAGTACCGCGTAATAAAAGCGGCTGGGCGCTGGGTACGCTCTCCACAGGCGGCGTTAGTGGTGCGTTGCTCGGCCCAATG
GCTGGCGGCCTGCTCGCCGATAGCTACGGCTTACGTCCGGTATTCTTTATTACCGCCAGTGTGCTCATACTCTGCTTTTT
CGTCACCCTGTTTTGCATCAGAGAAAAATTCCAGCCGGTCAGCAAAAAAGAGATGCTGCACATGCGGGAAGTGGTGACAT
CACTTAAAAACCCGAAACTGGTACTCAGCCTGTTTGTCACTACGTTAATCATCCAGGTGGCGACGGGCTCAATTGCCCCC
ATTCTGACGCTGTATGTCCGCGAACTGGCGGGTAACGTCAGTAACGTCGCCTTTATCAGTGGCATGATCGCCTCGGTGCC
AGGCGTGGCGGCTCTGCTAAGTGCACCACGACTCGGCAAACTTGGCGATCGAATCGGACCCGAAAAGATCCTGATTACAG
CGCTGATCTTTTCTGTACTGCTGTTGATCCCAATGTCTTACGTTCAGACGCCATTGCAACTTGGGATTTTACGTTTTTTG
CTCGGTGCCGCCGATGGTGCACTACTCCCCGCCGTACAGACACTGTTGGTTTACAACTCGAGCAACCAGATCGCCGGGCG
TATCTTCAGCTATAACCAATCGTTTCGTGATATTGGCAACGTTACCGGACCATTGATGGGAGCAGCGATTTCAGCGAACT
ACGGTTTCAGAGCGGTATTTCTCGTCACCGCTGGCGTAGTGTTATTCAACGCAGTCTATTCATGGAACAGTCTACGTCGT
CGTCGAATACCCCAGGTATCGAACTGA

>>MEG_3754|Multi-compound|Drug_and_biocide_resistance|Drug_and_biocide_MFS_efflux_pumps|MDTG
ATGTCACCCTGTGAAAATGACACCCCTATAAACTGGAAACGAAACCTGATCGTCGCCTGGCTAGGCTGTTTTCTTACCGG
GGCCGCCTTCAGTCTGGTAATGCCCTTCTTACCCCTCTACGTTGAGCAGCTTGGTGTTACCGGCCACTCCGCCCTGAATA
TGTGGTCCGGTATTGTCTTCAGCATTACATTTTTATTTTCGGCCATCGCCTCACCGTTTTGGGGTGGACTCGCCGACCGT
AAAGGTCGAAAACTCATGCTATTACGCTCTGCTCTCGGCATGGGCATCGTGATGGTGTTGATGGGACTGGCACAAAATAT
CTGGCAGTTTTTGATCCTACGGGCGCTTCTTGGGTTACTTGGCGGATTTGTCCCCAACGCTAATGCTCTTATCGCCACAC
AAGTACCGCGTAATAAAAGCGGCTGGGCGCTGGGTACGCTCTCCACAGGCGGCGTTAGTGGTGCGTTGCTCGGCCCAATG
GCTGGCGGCCTGCTCGCCGATAGCTACGGCTTACGTCCGGTATTCTTTATTACCGCCAGTGTGCTCATACTCTGCTTTTT
CGTCACCCTGTTTTGCATCAGAGAAAAATTCCAGCCGGTCAGCAAAAAAGAGATGCTGCACATGCGGGAAGTGGTGACAT
CACTTAAAAACCCGAAACTGGTACTCAGCCTGTTTGTCACTACGTTAATCATCCAGGTGGCGACGGGCTCAATTGCCCCC
ATTCTGACGCTGTATGTCCGCGAACTGGCGGGTAACGTCAGTAACGTCGCCTTTATCAGTGGCATGATCGCCTCGGTGCC
AGGCGTGGCGGCTCTGCTAAGTGCACCACGACTCGGCAAACTTGGCGATCGAATCGGACCCGAAAAGATCCTGATTACAG
CGCTGATCTTTTCTGTACTGCTGTTGATCCCAATGTCTTACGTTCAGACGCCATTGCAACTTGGGATTTTACGTTTTTTG
CTCGGTGCCGCCGATGGTGCACTACTCCCCGCCGTACAGACACTGTTGGTTTACAACTCGAGCAACCAGATCGCCGGGCG
TATCTTCAGCTATAACCAATCGTTTCGTGATATTGGCAACGTTACCGGACCATTGATGGGAGCAGCGATTTCAGCGAACT
ACGGTTTCAGAGCGGTATTTCTCGTCACCGCTGGCGTAGTGTTATTCAACGCAGTCTATTCATGGAACAGTCTACGTCGT
CGTCGAATACCCCAGGTATCGAACTGA