Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 41

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 42

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 43

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 44

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 45

Warning: Cannot modify header information - headers already sent by (output started at /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php:2640) in /home/meglabuser/megares.meglab.org/browse/download.php on line 46
>>MEG_1655|Metals|Chromium_resistance|Chromate_ABC_efflux_pump|CEUE GTGAAGAAAATGTTTTTCATGCTTTTGGGCGTTGTTTTTCTCTCTAGTGGCGCTTTTGGCATAGAATATGAGGATTATTTTGGCAAACATCAATTGCCCCAGATTCCCAAAAAGGTAATCTATCTCAGTGCTCATATTGAGGCTCCAGCAATGCTGGAAGTATGGGATAAGGTGGTGGGCATATCAGACTATGCCCTAAGAGATGATTTGGTGCGCCGCACTGCGCCGCTGGATAAAATTGAAAAATTCCCCACAGATCATTATGCAGCCATTGATGTGGAGCGTCTGAAAAAAATGGGAGTGGATTTGGTTATCACCTATCCTGCGAATTTGCAGGCTATTGAGTTTGCCCAGCGCTTTGGGATTCATTTCCTAGCATTGCGCACAGAAAGCATCAAGGCTTTGTTCCAAGATCTGCGCACGCAGGCAAAGATTTTTGGCAAGGAGGAATTAGCAGAGAAAAAGATTGCGATGATGCAGGGGACACTAGATATGATCCAAAAGCGTCTAGCTGGGGTCAAAAAAGAAAAAAGAGTGGTGGAGATGTTCCTGCGCCCCAATCATGTGAGTGGCAAAAATGGAATGGATTCCTCCATATTGGCAAGTGCAAAAGTGGATAACATCGGAAATAAATACGTAAGCCAACCAAGAGGCGAGATCAATATAGAGAATATCGTGAGAGAAAATCCTGATGTGATTTTCCTTTGGTGGCTCAGCCCTTATAGTCCTCAGGATATCATGAAGATTCCTCAGTTAAAAAATGTCTCTGCGATTAAAAATAAACAGGTGTTTAAACTCCCTAACATTGATATCACAGGGCCTAGGACACCACTCATTTCACTATTTGTCGCAATGCATGCGTATCCGAAATATTTCTCAGATATCAATTACACAAAATACGTGCAGGATTATGAAAAAAAGATGTTTCACATCAATCCATAA >>MEG_1705|Metals|Chromium_resistance|Chromium_resistance_protein|CHRA ATGAGCGTTGCGAATGAAGAGTCGTATCGCCCGAGCAAGGCGACGGATGCCACGACTGAAGCCGTCCCTCCACCCATGAGCTACCCACAGCTCTTCGCGCGCTTCCTCAAGTTCGGCTTGCTCGCATGGGGCGGGCCTGTGGCTCAGATCGACATGTTGCGCCGCGAGCTCGTGGACGAGGAACGCTGGATCTCCAGCAAACGCTTCAACAAGCTGCTTGCGGTGATGCAGGTGCTGCCCGGACCCGAAGCGCATGAAATATGCGTTCATTTGGGCATCCGAGCAAAGGGGCGGCTGGGGGGCGTGCTGGCGGGACTCGGTTTCATGCTTCCCGGATTCTTGCTGATGTTCGCGCTGTCCTGGTTGTACTTCCAGATTGAATTCGTGGGTACCGCGCTGGGCGCGGCGTTCCTTGGCGTGCAGGCGGCTGTGATCGCCCTGATCGTGCGCGCCGTGCACCGTATCGGCGAGCACATCCTGCTTGATCGCTGGTTGTGGGTCATTGCCATCGTTTGCGCGCTGGCAGCCATAGGTCGTGTCGACTTCTGGATCACCCTGCCGGCGGGCGGCCTTGTGTACGCCCTGCTCGTGCTGAATCATCGGGCCTCAGCGCTCTTGGTGACACTGGCGGCGGTGGCGCTGGCCGCGGCCGTGGCTTTGTGGGCTGCACCGACAGCGAAGCTTGTGGAAGCGGTCGTTCAGGGCCAGGCCTCGGTGCTGCTCATCTTCGCGTCGGGCCTGAAGGCCGGCTTGCTCACCTTCGGCGGCGCCTACACAGCGATTCCGTTCGTTCGCAACGACGCCGTCGGGCGCGGATGGATGACGGATGGGCAGTTCCTGGACGGCCTGGCGCTGTCCGGTGTGCTACCGGCACCCCTCATCATCTTCGCCACGTTCGTCGGCTATGTGGCGGGGGGGCCGATCGGGGCGGTGGCCATGACGGTGGGTGTCTTTCTTCCGGCCTTTGCGTTCTCGCTGATTTTCTACGACCGGCTGGAGGCGGTCGTGGAGAACAAACGGCTGCACGCCTTTCTGGACGGCGTCGCGGCTGGGGTAGTCGGCCTGATCGGCGCAACCACCATCGACTTGGCGCAGGTCACTGCTGAACGTGTCCCATCGTTGACGGTGGGCATGTCGATTTTCGCCGCAGGCTTGGCATTCCTTTATGCCTGGAAGAACAAGCTCAACGTCGTCGTCGTGATCCTCGCGGCGGGATTGGCGGGGTGGCTGGTATTTCCGAACCAAGGCTGA >>MEG_1706|Metals|Chromium_resistance|Chromium_resistance_protein|CHRA ATGACTCAAACCGTCGTAACCAAGGAGGCTGTGGCAGTGCCTCCCTCCCCACAAGTTGTCAGCTTTTGGCAAGCGTTTCGCCTGTGGTTAAAGATCGGGTTCATAGGCTTCGGCGGCCCCGCCGGACAGATCGCGATCATGCACCGCGAATTGGTCGAACAGCGGCGCTGGATCAGCGAGCGTCGCTTTCTGCATGCGCTCAACTTCTGCATGCTGCTTCCGGGCCCGGAGGGGCAGCAACTCGCCACATACATGGGCTGGCTAATGCACCGAACTTGGGGAGGCATAGTTGCAGGTGTCCTGTTTGTGCTGCCTTCGCTCTTCTTTCTGATCGCGCTGTCGTGGATTTACATTGCGTTCGGTGACACGCCGCTGGTTTCCGGCCTGTTCTACGGCATCAAACCTGCCATCACCGCGGTTGTCGTGCAGGCCGTGCATCGGATCGGCTCGCGTGCTCTCAAGAACGGCCTGATGGGCCTGATGTGGGCGATTGCCGCTGGGGCATTCGTCGCCATCTTCGCGATGAATGTGCCGTTTCCGGCCATCGTCGCCGGGGCCGCGCTGATAGGGTATATCGGCGGTCGCGTTACCCCGGACAAATTCAGGGCCGGCGGCGCGCATCGTGCGGCCGATAAATCCTATGGCCCCGTGCTGATCGATGACAACACCCCCATACCGTCGCACGCCCTGTTCCGCTGGTCTGGCTTGCTGCGGGTTGCCGCGATGGGTTGCCTGTTGTGGCTGATCCCCATGGCATTCCTTCTCGGCACCTATGGCTGGGACCACACCCTGACCCAGATGGGCTGGTTCTTTACGAAAGCCGCATTACTGACCTTTGGGGGGGCCTATGCAGTATTGCCGTACATCTATCAGGGTGCGGTCGGCCATTACAGTTGGCTCACCCCCACGCAGATGGTCGATGGGTTGGCGCTCGGCGAGGCCAATCCGGGGCCGCTCATTATGGTGGTGGCCTTCGTCGGCTTTGTGGGGGCCTATGTACAGGCACTATTCGGCCCCGACATGTTGTTCGTTGCCGGTGCGGTCGCAGCCGCGCTGGTGACCTGGTTCACTTTCCTGCCGTCCTTCATTTTCATCCTCGCCGGAGGGCCGTTCGTAGAGTCGACGCGCGGAGATCTCCGGTTTACCGCGCCGCTGACTGCGATAACGGCAGCGGTGGTCGGTGTGATCCTGAACCTGGCCGTGTTTTTCGCCTATCACGTGCTCTGGCCCAAAGGCCTCGCCGGGCACTTCGACTGGGTGTCGGCACTGATCACCATCGGTGCGGCAGTGGCCTTGTTCCGCTTCAAGCGAAACGTGATTCACGTCATCGCGGCATGTGCGGTGCTGGGCCTGATATTGAAGACCTTGATCTTGTGA >>MEG_1707|Metals|Chromium_resistance|Chromium_resistance_protein|CHRA ATGAACTCGCCCCAACCACCCGATACCACTGCAGCCGGTTCGGTACATACCGCGCCCACTTATACGCTACGCCAACTGGTGATGTACTTCCTGCGGCTTGGCACCCTCGGCTTTGGCGGTCCCGTGGCGCTAGCCGGCTACATGCACCGCGACCTCGTCGAGGCAAAGCAGTGGATCACCGATGCCGACTACAAGGAAGGCCTTGCCCTGGCCCAGCTCGCGCCGGGACCGCTTGCCGCTCAACTGGCCATTTACCTGGGATACGTCCACTACCGCATCGTAGGCGCAACGCTCGTCGGCGTGGCCTTTGTACTGCCGTCGTTTCTCATGGTGTTGGCACTCGGGTGGGCATATGTGCGCTTCGGCGGCCTGACCTGGATGCAGTCGGTATTCTATGGCGTAGGCGCAGCAGTGATTGGCATCATCGCAATCAGCGCGTACAAGCTGACCAAAAAGAGCGTCGGCAACGACAAGTTGCTCTGGTTTATCTATCTGGTGCTCGTGGCCGTCACGGTCATTACAGAATCGGAAGTGGCGTGGCTGTTCCTTGCCGCGGGCGTCCTGGTCTGGTTCTGGCGCGCCCCGCCGAAGTGGCTGCGCCAAGGCAAGATGAATGCGTTCGCTGCGACCCCACTGCCGGCGGCAAGCGGCATGATGAGTACGTTGGATTGGCCGCTTCTTTCCCAGATTGGCGTGTTCTTTGCCAAGGCGGGAGCCTTCGTTTTCGGGTCGGGACTTGCCATCGTGCCGTTCCTGTACGGTGGTGTGGTGACGGAGTACCACTGGCTGAACGACAAGCAGTTTGTCGATGCCGTCGCAGTCGCCATGATCACACCCGGCCCGGTGGTCATCACCGTTGGCTTCATTGGCTACCTCGTCGCCGGCCTGCCTGGCGCCTGCGTGGCTGCGGCCGCAACGTTTCTACCGTGCTACCTGTTCACCGTCCTACCCGCCCCATATTTCAAGAAATACGGAAAACTACCTGCGATCCTCGCCTTTGTGGACGGTGTCACCGCGGCGGCCATCGGCGCCATTACTGGCGCGGTGATCGTGTTGGCGAAGCGGTCGATCGTTGATATCCCGACAGCGTTGCTGGCGCTTGTCACCGTCGCATTGCTTCTGAAGTTCAAGAAGCTGTCCGAGCCCATGATCGTTGCCGGGGCGGCCTTGATTGGTCTGGTCGCCTATCCGTTGTTGCATCACTGA >>MEG_1708|Metals|Chromium_resistance|Chromium_resistance_protein|CHRA ATGTACTTCCTGCGGCTTGGCACCCTCGGCTTTGGCGGTCCCGTGGCGCTAGCCGGCTACATGCACCGCGACCTCGTCGAGGCAAAGCAGTGGATCACCGATGCCGACTACAAGGAAGGCCTTGCCCTGGCCCAGCTCGCGCCGGGACCGCTTGCCGCTCAACTGGCCATTTACCTGGGATACGTCCACTACCGCATCGTAGGCGCAACGCTCGTCGGCGTGGCCTTTGTACTGCCGTCGTTTCTCATGGTGTTGGCACTCGGGTGGGCATATGTGCGCTTCGGCGGCCTGACCTGGATGCAGTCGGTATTCTATGGCGTAGGCGCAGCAGTGATTGGCATCATCGCAATCAGCGCGTACAAGCTGACCAAAAAGAGCGTCGGCAACGACAAGTTGCTCTGGTTTATCTATCTGGTGCTCGTGGCCGTCACGGTCATTACAGAATCGGAAGTGGCGTGGCTGTTCCTTGCCGCGGGCGTCCTGGTCTGGTTCTGGCGCGCCCCGCCGAAGTGGCTGCGCCAAGGCAAGATGAATGCGTTCGCTGCGACCCCACTGCCGGCGGCAAGCGGCATGATGAGTACGTTGGATTGGCCGCTTCTTTCCCAGATTGGCGTGTTCTTTGCCAAGGCGGGAGCCTTCGTTTTCGGGTCGGGACTTGCCATCGTGCCGTTCCTGTACGGTGGTGTGGTGACGGAGTACCACTGGCTGAACGACAAGCAGTTTGTCGATGCCGTCGCAGTCGCCATGATCACACCCGGCCCGGTGGTCATCACCGTTGGCTTCATTGGCTACCTCGTCGCCGGCCTGCCTGGCGCCTGCGTGGCTGCGGCCGCAACGTTTCTACCGTGCTACCTGTTCACCGTCCTACCCGCCCCATATTTCAAGAAATACGGAAAACTACCTGCGATCCTCGCCTTTGTGGACGGTGTCACCGCGGCGGCCATCGGCGCCATTACTGGCGCGGTGATCGTGTTGGCGAAGCGGTCGATCGTTGATATCCCGACAGCGTTGCTGGCGCTTGTCACCGTCGCATTGCTTCTGAAGTTCAAGAAGCTGTCCGAGCCCATGATCGTTGCCGGGGCGGCCTTGATTGGTCTGGTCGCCTATCCGTTGTTGCATCACTGA >>MEG_1710|Metals|Chromium_resistance|Chromium_resistance_protein|CHRB1 ATGAACGCTCTCCCATCCTCTCCCGAGACTGCCTGGCTACTGCTCGTCGTTAGCTTGCCAACATCCGCCTCCACTGCGCGCATGCGATTCTGGCGCGGGATCAAGGCGCTTGGCGCCACAGCACTGCGGGACGGGGCCTATCTACTCCCCAATCTGCCAGGACTGCGGGCACCTTTGCAGACACTGGCAACCGATGCGGCCAGTGAGGATGGCAAGGTCTGGATGCTGTCCGTACAGGCCGCTGACGACCAGCAGGAGGCGGAGTATCGCGCGTTGTTCGACCGGTCCACCGAATATGCCGAATGGATGGTCGAACTCTCCAGCGCCCGCTCAACATTGTCCGATTCGGACGAGGCGGAGCTGCTGCGCGTGGCACGCCGGCACGGTCGAGGGATCGACGCTATCCGCAAGGTCGATTTTTTCCCTAACGAGGCGTCCGCCCGTGCCGAATTGCAGTGGCGCGACTTCAATGCAGCGATCGACATCTTGCTTTCGCCCGGCGAGCCGCACGGAGTAGCCGGCAACATTCCGCGACGTGACCCGACCCAGTATCAGGGGCGCCAGTGGGCGACCCGCCAGCATCTATGGGTAGACCGTGTCGCCTGCGCTTGGTTGATCCGGCGCTTTATCGATCCCCATGCCACTTTTCTCTGGCTCGAAGATGTCCGTCAGTGCCCTGACGACGCACTTGGATTCGACTTCGATGGCGCGACGTTCACACACATTGGCGACCGCGTTTCGTTTGAGGTGCTGCTCGCCAGCTTCGGACTAGACGAAGACAAAGGGCTCGCCCGCCTCGGCCAGATGATCCATGTTCTGGATGTCGGCGGCACACCGGTTGCCGAAGCCAGTGGCTTTGAGGCAGTGCTGGCAGGCGCCCGGGAACGCCTCCCTAACGACGACGCACTGCTGGATGAAGTCGGCTATGTCCTCGACTCGCTGTACACGCATTTCTCAAGCCCGCGCAAACGCTAG >>MEG_1711|Metals|Chromium_resistance|Chromium_resistance_protein|CHRB1 ATGCGATTCTGGCGCGGGATCAAGGCGCTTGGCGCCACAGCACTGCGGGACGGGGCCTATCTACTCCCCAATCTGCCAGGACTGCGGGCACCTTTGCAGACACTGGCAACCGATGCGGCCAGTGAGGATGGCAAGGTCTGGATGCTGTCCGTACAGGCCGCTGACGACCAGCAGGAGGCGGAGTATCGCGCGTTGTTCGACCGGTCCACCGAATATGCCGAATGGATGGTCGAACTCTCCAGCGCCCGCTCAACATTGTCCGATTCGGACGAGGCGGAGCTGCTGCGCGTGGCACGCCGGCACGGTCGAGGGATCGACGCTATCCGCAAGGTCGATTTTTTCCCTAACGAGGCGTCCGCCCGTGCCGAATTGCAGTGGCGCGACTTCAATGCAGCGATCGACATCTTGCTTTCGCCCGGCGAGCCGCACGGAGTAGCCGGCAACATTCCGCGACGTGACCCGACCCAGTATCAGGGGCGCCAGTGGGCGACCCGCCAGCATCTATGGGTAGACCGTGTCGCCTGCGCTTGGTTGATCCGGCGCTTTATCGATCCCCATGCCACTTTTCTCTGGCTCGAAGATGTCCGTCAGTGCCCTGACGACGCACTTGGATTCGACTTCGATGGCGCGACGTTCACACACATTGGCGACCGCGTTTCGTTTGAGGTGCTGCTCGCCAGCTTCGGACTAGACGAAGACAAAGGGCTCGCCCGCCTCGGCCAGATGATCCATGTTCTGGATGTCGGCGGCACACCGGTTGCCGAAGCCAGTGGCTTTGAGGCAGTGCTGGCAGGCGCCCGGGAACGCCTCCCTAACGACGACGCACTGCTGGATGAAGTCGGCTATGTCCTCGACTCGCTGTACACGCATTTCTCAAGCCCGCGCAAACGCTAG >>MEG_1713|Metals|Chromium_resistance|Chromium_resistance_protein|CHRC ATGCTCTACGAAATGAAGCCGCTAGGTTGTGAACCTGCGAAGCTGACTGGCCTCTCCGAGAAGCTGATCTTCAGCCACTATGAGAACAATTATGGCGGCGCGGTCAAGCGACTGAATGCCATTACGGCCACGCTCGCAGAGCTGGATATGGCAACCGCTCCCGTGTTCACGCTCAACGGACTGAAGCGCGAAGAACTCATCGCGACGAATTCCATGATTCTGCATGAGGTGTACTTCGACAGCCTGGGTGACGGCGGTTCGCTGGACGGTGCTTTAAAGACGGCGATCGAACGTGATTTCGGCTCGGTCGAACGCTGGCAGGCCGAATTCACCGCGATGGGCAAGGCGCTCGGCGGCGGATCGGGCTGGGTACTGCTTACTTACTCGCCGCGTGACGGGCGGCTGGTCAACCAGTGGGCATCTGACCACGCCCATACGTTGGCTGGGGGTACACCGGTCCTGGCGCTCGATATGTATGAGCACTCCTACCACATGGACTACGGCGCAAAGGCGGCAGCTTATGTGGACGCGTTCATGCAGAACATCCACTGGCAACGGGCGGCCACTCGCTTCGCGGCTGCCGTGCGGGACTAA >>MEG_1714|Metals|Chromium_resistance|Chromium_resistance_protein|CHRE ATGCCTAACGCCACATCTTCCTTGGAACTCGCGGCTGCCTTGCACGGATTAAACGCCCCGCAGTTGATCGACGTCCGGCGTAAGCCTGCGTTCGATGCGAGTGAACAAATGATTGCGGGGGCTGCCTGGCGCAATCCGGACGAACTTGGCAACTGGATCGCCACGCTTGATGCGAATCGCCCGGTTACCGTCTATTGCGTCCACGGCCACCAGGTCAGCCAGGACTGCGCAGCGCTACTCGAGGCCGTTGGCTTCGACGCGACGTATCTGGTTGGTGGATTCGAAGACTGGATCGCAGGTAATCACCCGACGATTCGGAAACCATTACGGATAGAGCCATGA >>MEG_1715|Metals|Chromium_resistance|Chromium_resistance_regulator|CHRF ATGAAATGGATCACACGTGAACGGCCAAAGATCGATCGTATTGCCTGCCCATGGCTGATCGCCCGATTTGTCGATGACGCGCCCGACTTCCTGTATGTACCGTCGGGCGACGTGGTTCGCATCGCCAACGAAACCGGCGCGATCCCCTACGACATCCCAGGTGTTGAGCTCACGCACGTCGGTGAGCTGTGCAGCTTCGACGCGTTTCTGGAGAAGTACAAGTTAGGCGAGAATCCGGCCCTTCAGCAACTAGCCAGCATTGTTCGCGGTGCGGATACCTCGCGGCTCGACCTCACGCCGCAGTCAAGCGGGCTCTACGCCATTTCACTAGGGCTTTCTCATGTCTTCACGAATGACCACGAGATGCTTGCGCAAGGCGTGGTGATGTACGACGCATTGTACGCATGGTGTCAAAGCTGTTAG >>MEG_1716|Metals|Chromium_resistance|Chromium_resistance_regulator|CHRI ATGGCGGATGTATGGCCAGCCCCTATGGAGTTACAAGAATTCATCGCCCCCTGCGCATACGACAGAGCCCTCTACATCCGGGCCATCGTTCTTGTTGCCGAGTTGGGTCTATTTAGGAGGTGCCTTATGAAAGGACTCTCGATCGCATTGATTGTGATGGGATATCTCGCCGTTCCTTCTGCTGTTGCCGCCGCCCCGCACGCAAGCGAAGGCATTCTGGTCGACGAACAGGGAATGACGTTGTACGTCTTCGCTGGAAAGAGCAGCCCCGATGCCAAATCCTGCGAGGGGAACTGCGAGCGGAATTTTCCACCTGCACTCGCCGCTTCCGACGACAAACCGGTTGGGATGCTCACGCTAGTCCCCGGCCGCGGTGGTAAATCGCAATGGGCTTATCAAGGAAAGCCGTTGTATCGCGGCCTGATGGACAAGAAGCCAGGCGACCGTTCAGGGGATGGTCTGAATGAGGTTTGGCACAGCGTGCCTGTGCGATGA >>MEG_1717|Metals|Chromium_resistance|Chromium_resistance_protein|CHRR ATGGTAAAAGAATTATTACGTAACCACTCTTCAGTTCGTATTTATGATGGAAATCCGATTTCAAAGGAAATTATTGAAGAATTAATTGCTACTGCTCAAATGGCGGCTACATCACATTTTGTACAAGCTTATAGTGTTATTTGGGTAACTGATGAGGAGAAAAAAGAAAAATTAGGGATGCTCTCTGGTAATCCCCGTCAATATGAAACTTCTGGCGGCGCCTTTGTCTTCTGTGTAGATTTCAAACGTCTTCAATCAGCAGGCAAATTAGAAGGTGTAGACATTGTCGCTGATTCCGCAGAAAATGTACTTGTTGGAGTAGCTGATGTATCATTATTCGCGCAAAACTTTGTGGTTGCTGCAGAATCTATGGGATATGGAATTTGTTACATCGGAGGAGTGCGTAATAAGCCTGAAGAAATAAGCGAACTATTTAATCTACCTGAATACGTTTTCCCTCTATTCGGCTTAACAATTGGGGTTCCCGCACGTCGTAATGAAGTAAAACCTCGTTTACCTGTTGCCGCGGTATTACATGAAAATGAATACAATACAGAAAAATATGAGGAACTTTTACCAGCTTATAACGACACAATGGAAGCATACTATAATAATCGCTCATCCAATCGAAAAATTGATAACTGGACAAAGCAAATGGCAGATTTTTTAATTGAACAACGCCGTCCCCATATCAAAGATTTCTTAGCGAAAAAGGGTTTTAATTGGAAATAA >>MEG_4160|Metals|Chromium_resistance|Chromium_resistance_protein|NFSA ATGACGCCAACCATTGAACTTATTTGTGGCCATCGCTCCATTCGCCATTTCACTGATGAACCCATTTCCGAAGCGCAGCGTGAGGCGATTATTAACAGCGCCCGTGCGACGTCCAGTTCCAGTTTTTTGCAGTGCAGTAGCATTATTCGCATTACCGACAAAGCGTTACGTGAAGAACTGGTGACGCTGACCGGCGGGCAAAAACACGTAGCGCAAGCGGCGGAGTTCTGGGTGTTCTGTGCCGACTTTAACCGCCATTTACAGATCTGTCCGGATGCTCAGCTCGGCCTGGCGGAACAACTGTTGCTCGGTGTCGTTGATACGGCAATGATGGCGCAGAATGCATTAATCGCAGCGGAATCGCTGGGATTGGGCGGGGTATATATCGGCGGCCTGCGCAATAATATTGAAGCGGTGACGAAACTGCTTAAATTACCGCAGCATGTTCTGCCGCTGTTTGGGCTGTGCCTTGGCTGGCCTGCGGATAATCCGGATCTTAAGCCGCGTTTACCGGCCTCCATTTTGGTGCATGAAAACAGCTATCAACCGCTGGATAAAGGCGCACTGGCGCAGTATGACGAGCAACTGGCGGAATATTACCTCACCCGTGGCAGCAATAATCGCCGGGATACCTGGAGCGATCATATCCGCCGAACAATCATTAAAGAAAGCCGCCCATTTATTCTGGATTATTTGCACAAACAGGGTTGGGCGACGCGCTAA >>MEG_6052|Metals|Chromium_resistance|Chromium_resistance_protein|RECG CGAATTCAAGGCCGGGGCACTGCAATTGCTGGTCGCCACCACGGTGATCGAAGTCGGGGTCGATGTGCCCAATGCCAGCTTGATGATCATCGAGAACCCCGAGCGCCTGGGTCTGGCACAGTTGCATCAGCTACGCGGCCGCGTCGGCCGGGGCAGTGCCGCCAGCCATTGCGTCTTGCTGTATCACCCGCCGCTGTCGCAGATTGGTCGCCAGCGCCTGGGCATCATGCGCGAAACCAACGATGGTTTTGTCATCGCCGAAAAAGACCTGGAATTACGCGGACCCGGTGAAATGCTCGGCACGCGCCAGACCGGCCTGCTTCAATTCAAGGTAGCCGACCTGATGCGCGACGCCGATCTGCTCCCCGCCGTACGCGACGCCGCCCAGGCGCTGCTGGAGCGCTGGCCGGAGCATGTCAGCCCGCTGCTGGATCGCTGGTTGCGTCACGGGCAGCAATACGGCCAAGTGTGA >>MEG_6562|Metals|Chromium_resistance|Chromium_resistance_protein|SRPCC ATGAAAGATTCTGACTCTTTACTTCATGTCCATCCAGCATATTCACTCAAGCAGCTGACCCAGTATTTTCTGAAGCTAGGAGCACTGGGCTTTGGGGGGCCAATCGCTTTAGTTGGCTACATGCATCGGGATCTCGTGGAAGAACGCCAATGGGTCTCCGAGGCAGAGTATCAAGAAGGACTGACCCTCGCTCAAGTCGCTCCTGGCCCACTGGCAGCGCAACTATCATTTTATTTAGGTTACGTTCACTATGGATTTTTAGGATCAGCATTAGTTGGACTTGCTTTTGTTCTTCCATCTTTCCTGATTGTTGTTGCTTTGGGATGGGCTTATACCCTTTATGGCGGCTTAAATTGGATGCAGGCAGTATTTTATGGCGTTGGCGCTGCTGTAATTGGGATCATTGCTATTAGTGCATATAAATTAACGCGGAAAACAGTTGGGACAAGCTGGTTATTGTGGAGTATTTATTTGGTTAATGCCGCTACAACAATTGTGACGGAATCAGAACGAGTGGAGCTAATCTTGGGGTCGGGGGCTCTTGTTTTACTCGTTAAGTTCCCACCTAAGCACTGGATCAAGCAGAACCGCTTAAATAGTTTTATTGGGCTGCCTCTGATCCCACTCTTTGCAGCAGTACCAACTGCAACTACAAGTCTGCTTGGTCAGATTGCCCTCTTTTTCACCCAAGCAGGTGCATTTGTCTTTGGCAGTGGACTTGCTATTGTCCCCTTCTTGTATGGCGGTGTTGTCAAAGACTTTGGCTGGCTCAACTCCCAGCAATTTTTAGATGCTGTAGCTGTTGCGATGATTACGCCCGGACCCGTTGTCATTACAACGGGTTTTATTGGTTTCCTAGTCGCTGGATTTCCGGGTGCTTGTGTTGCGGCGATCGCGATGTTTATTCCCTGTTATCTTCTGACAGTGATTCCCGCACCCTATTTTAAAAAGCATGGGAAGAACCCTAAGATTTCTACATTTGTAAATGGTGTGACTGTCGCAGCAACTGGAGCGATCGCAGGAGCTGTTGTTGTTCTAGGCCGACAATCTCTCCATGATCTACCGACATTTTTGATTGGACTCATCGCTTTAATTAGCTCATGGAAGCTAGGTAAAAAGCTGCCAGAGCCTTTAATTATTGTGATTGCAGCGATCGCGGGAGTCATTTTCTGGTCTAAGTAG