MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

NOVA

The novA gene encodes a type III bacterial ABC transporter that is implicated in the active extrusion of novobiocin, an Aminocoumarin antibiotic. Removal of the antibiotic results in resistance to the drug.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/12604514

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Sequences

Download Sequences

>>MEG_4214|Drugs|Aminocoumarins|Aminocoumarin_efflux_pump|NOVA
ATGAAGTCCGCACTCTCGACCTGGAAGCCCTCGGACCGGCCGCCGGATCCGACACTGCCCGAGCCGCCGGCCCAGCTGCG
CCGCATCTTCCGGCTCTTCCGCCCGTACCGCGGCAGGCTCGCCGTCGTCGGCCTGCTCGTCGGCGCCTCGTCGCTGGTGG
CCGTCGCCTCGCCGTTCATGCTGCGCGAGATCCTCGACACCGCGATCCCGCAGGGCCGCACCGGGCTGCTCAGCCTGCTC
GCCCTCGGCATGATCCTGACCGCCGTCCTCAGCAGCGTCTTCGGCGTCGTCCAGACCCTCATCTCCACGACGGTCGGCCA
GCGCGTCATGCACGACCTGCGCACCGCCGTCTACGCGCAGCTCCAGCGCATGCCCCTCGCGTTCTTCACCCGCACCCGCA
CCGGTGAGGTCCAGTCCCGGATAGCCAACGACATCGGCGGCATGCAGGCGACCGTCACCTCAACCGCCACGTCGCTGGTC
TCCAACCTCACCGCCGTCATCGCCACCGTCGTCGCGATGCTCGCGCTGGACTGGCGGCTGACCGTCGTCTCGCTGCTCCT
GCTGCCGGTGTTCGTCTGGATCAGCCGCCGCGTCGGCCGTGAGCGCAAACGGATCACCCTGCAACGGCAGAAGCAGATGG
CCACGATGGCCGCCACGGTCACGGAGTCGCTGTCGGTCAGCGGCATCCTCCTCGGCCGCACGATGGGGCGCGCCGACTCG
CTCACCAGATCCTTCGCCGAGGAGTCCGAGCGACTCGTCGACCTGGAGGTCCGCTCCAACATGGCCGGGCGGTGGCGGAT
GTCCGTCATCGGCATCGTCATGGCCGCCATGCCCGCCGTCATCTACTGGGCGGCCGGCTTCGTCCTCCAGTCCGGCGGCA
CGGTCGTCTCCATCGGCACACTCGTCGCCTTCGTCTCCCTCCAGCAGGGCCTCTTCCGCCCGGCCGTGAGCCTGCTCGCC
ACCGGCGTGCAGATGCAGACGTCCCTCGCGCTCTTCCAGCGCATCTTCGAATATCTCGACCTGCCCGTCGACATCACCGA
ACCCGAGCGTCCGGTGGCCCTCGACAAGGTCCGGGGCGAAGTGCGCTTCGACGGCGTCGACTTCAGTTACGAGGAGAAGG
ACGGCAACACCCTCCACGGCCTGGATCTGACCGTCCCGGCCGGCGGCAGCCTCGCCGTCGTCGGTCCCACCGGATCGGGC
AAGTCGACCCTGAGCTATCTCGTGCCGCGTCTGTACGACGTGACGGGCGGCCGGGTCCTGCTCGACGGCGTCGACGTACG
CGACCTGGCCTTCGACACCCTCGCCCGCGCGGTGGGCGTCGTGTCGCAGGAGACGTATCTCTTCCACGCCTCCGTCGCCG
ACAACCTCCGCTTCGCCAAACCGGACGCGACGGACGAGGAGATCGAGAAGGCGGCCAGGGCCGCCCAGATCCACGAGCAC
ATCGTCACCCTGCCCGACGGGTACGACACACTGGTCGGCGAGCGCGGATACCGGTTCTCCGGCGGCGAGAAACAGCGCCT
CGCGATCGCCCGCACCATCCTGCGCGACCCGCCCGTCCTCGTGCTGGACGAGGCGACGAGCGCGCTCGACACCCGTACCG
AACACGCGGTCCAGCAGGCCATCGACTCCCTCTCCGAGGGCCGTACGACCATCACCATCGCCCACCGGCTCTCCACGGTG
CGCGACGCCGACCAGATCGTCGTCCTCGACGCCGGTCGCATAGCCGAGCGCGGCACGCACGAGGAGCTGATCGACCGGGA
CGGCAGGTACGCGGCGCTCGTCCGCCGGGACGGCGCGCCGGCGCCCGCGCCCGTGCCCGCCCGGGACGAGCGCGTGGGCG
CCGCCTGA