MEGAResFrom MEG, the Microbial Ecology Group

MECI

The mecI gene is a regulator present in the mec complex along with mecA/B/C and mecR1.

References

Other Groups in Penicillin binding protein regulator

Sequences

Download Sequences

>Bla|NC_002745.1122814|betalactams|Penicillin_binding_protein_regulator|MECI
ATGGATAATAAAACGTATGAAATATCATCTGCAGAATGGGAAGTTATGAATATCATTTGGATGAAAAAATATGCAAGTGC
GAATAATATAATAGAAGAAATACAAATGCAAAAGGACTGGAGTCCAAAAACCATTCGTACACTTATAACGAGATTGTATA
AAAAGGGATTTATAGATCGTAAAAAAGACAATAAAATTTTTCAATATTACTCTCTTGTAGAAGAAAGTGATATAAAATAT
AAAACATCTAAAAACTTTATCAATAAAGTATACAAAGGCGGTTTCAATTCACTTGTCTTAAACTTTGTAGAAAAAGAAGA
TCTATCACAAGATGAAATAGAAGAATTGAGAAATATATTGAATAAAAAATAA