MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

MECI

The mecI gene is a regulator present in the mec complex along with mecA/B/C and mecR1.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3780952/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Penicillin binding protein regulator

Sequences

Download Sequences

>>MEG_3802|Drugs|betalactams|Penicillin_binding_protein_regulator|MECI
atgacacgtgaaggctatgatatatcagcgtcagaatgggaaataatgaatacgatttggaataaaaaattaataagtgc
taatgacgttatagaaatagtacaaaagcacaaggaatggagtccaaaaacaataagaacactaatcaatcgtctttaca
aaaagaaattcatagatagaacaagtcgaaataaaatttttgaatatttcccaatagtagaggaaaaagatatgaagtac
aaaacgtctaaagtgtttttggataaagtgtatgaaggtggattaaattcattagtcttaaattttgttgaaaatgaaga
attgtccgaagatgatattgaagaattgaaaaatatattaaataataaatattaa

>>MEG_3803|Drugs|betalactams|Penicillin_binding_protein_regulator|MECI
atggataataaaacgtatgaaatatcatctgcagaatgggaagttatgaatatcatttggatgaaaaaatatgcaagtac
gaataatataatagaagaaatacaaatgcaaaaggactggagtccaaaaaccattcgtacacttataacgagattgtata
aaaagggatttatagatcgtaaaaaagacaataaaatttttcaatattactctcttgtagaagaaagtgatataaaatat
aaaacatctaaaaactttatcaataaagtatacaaaggcggtttcaattcacttgtcttaaactttgtagaaaaagaaga
tctatcacaagatgaaatagaagaattgagaaatatattgaataaaaaataa

>>MEG_3804|Drugs|betalactams|Penicillin_binding_protein_regulator|MECI
ATGGATAATAAAACGTATGAAATATCATCTGCAGAATGGGAAGTTATGAATATCATTTGGATGAAAAAATATGCAAGTGC
GAATAATATAATAGAAGAAATACAAATGCAAAAGGACTGGAGTCCAAAAACCATTCGTACACTTATAACGAGATTGTATA
AAAAGGGATTTATAGATCGTAAAAAAGACAATAAAATTTTTCAATATTACTCTCTTGTAGAAGAAAGTGATATAAAATAT
AAAACATCTAAAAACTTTATCAATAAAGTATACAAAGGCGGTTTCAATTCACTTGTCTTAAACTTTGTAGAAAAAGAAGA
TCTATCACAAGATGAAATAGAAGAATTGAGAAATATATTGAATAAAAAATAA