MEGAResFrom MEG, the Microbial Ecology Group

BLAR

The BlaR gene is a sensor-transducer that inhibits the production of PBP2a when beta-lactams are present. This results in fewer targets for the drug to bind and resistance to the beta-lactam antibiotic.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/12591921

Other Groups in Penicillin binding protein regulator

Sequences

Download Sequences

>>MEG_1298|Drugs|betalactams|Penicillin_binding_protein_regulator|BLAR
atgaaagcttataattttttatcatacatgtcttattctactatttccataactttagttattattgctttaatattaat
tagaggaatatttggtaaatggattagtgctaaacataaatattatttgtggcttatattaataatcaaactaattatac
catttacgcctaattggaatggggataattttaattttattaattggttctcaaaaagtttagttactaacgctaatact
gctatggataaagtaggaaataaatatagctcaataccattaatagataatactaaagattatgctgtatcagtaaatgt
ttcaaatgtatattcctttatttttatattatggctcttgatttgtgttgtaattcttggctttatccttgtaaatagct
ttagatttaaaactaaaataattaaaagtggttataaacctgataataaactaaaaataataatagaaacctgtagaaaa
caattaaaaatgaaaaataataagtttaatagtttaataattaaaggtgctcatgcagcttttgtagttggaccaataaa
accatacgtgattatttcacaggatatatgtgatgaattcaatgatgaagaaatcaaatatatcctgcttcatgaaatag
ctcacttaaagagaaaagatattatgattaagtttattatgataatattttgctgtatatattggtttaatccttttatt
tggatagccagagctattatgatgaatgatatggaattgtcctgtgatgagaaggttttgagcaacttaaacaagaatga
aatacaggattatggtaaaacgattattaaggtgttagaaagattctctttaaatagacataaaggtgttatgttaaata
tcaatgggtcaaagaaaaatataaaaaatagaataaaaaatatagcaatattttctaagcaaactataagacgtaggttt
ttaacatttttattactggtaattatcttactgctaacaataacatttataggtgtaaagactccatttgcaaatgataa
gtttaaaagtcttaattcaaatgttatatataaagatttttctaaagattttaatggagataaggggacttttgtgttat
ttaatgaacagagtaatcaatataccatattcaataaagagggaagcgagaagagagtttcaccttgttcaacatacaag
atagtaattgcattgatcggactggataaggaagtaataagtaaaactgataataatattagctgggatggtaagaatta
tccattcacagagtggaataaagatcagactttagaatctgctatgaattactcagttaattggtactttgacaaaatag
atagcagaataagtagaaaaactctacaagaatgtgtagattcattaagttatggaaacgaaaatattcggactctagat
ggccagtactggaatcaatcgtcattaaaaatttcagctatagaacaggttcagtttttgaaaaagctttggaactatga
tgtgaagtttaaaaaagaagatgtggattttgttaagaattctataaagcttatggaagaaggtgatgtgattttatatg
gtaagaccggatcaggaagtgagaacaataaagatgttaacggttggtttgtaggtgtcttagaaaaaggaaataataaa
tattactttgctacaaacattgaaggtagcaacaatattaatggacaaaaggcaaaaagcatagcagtggatattttaaa
ggagaataagattataaattaa

>>MEG_1299|Drugs|betalactams|Penicillin_binding_protein_regulator|BLAR
atggctaaattactaataacgagcgtagtaagcttttgttttatatttctattgttagtattttttaagtacatattaaa
acgctattttaattatagtttaaattataaagtttggtatctaacagtgcttgctggattaataccttttatcccaatta
aattctcttttataaaatttaataatgtgaataatcaagcgcccacagttgaaagtaagtcacacgacttgaaccataac
ataaataccaccaaacctattcaagagttcacaacagatatccataagtttaattgggattcaattgataatatctgcac
agttgtttggatagttttagttattattttaagttttaaatttttgaaatccttattatatcttaaatatttaaagaaac
agtcactttatctaaacgaaaatgaaaaaaataaagtagatacgatacttttcaaccatcaatataaaaaaaatattgtg
attcgaaaagcagagactattcaatctccaataactttttggtatgggaaatatattattttgattcctagttcatattt
taaaagtgtaattgataaaagactaaaatatataatactgcatgaatatgctcatgctaaaaatagagatactttacatt
taattatctttaatatcttctctattgttatgagttacaatccattaatacatattgtaaaaagaaagataattcatgac
aatgaagtagaagctgatagatttgttcttaataatattaacaaaaatgaatttaaaacttatgcggaatctattatgga
ctccgtattaaatattccattttttaataaaaatatattaagccattcatttaatggtaaaaagtcattactcaaaagaa
gattaattaatataaaagaagccaatttgaaaaaacagtctaaattaattccaatttttatttgtatttttacttttttg
ctcatagtaattcaaagccagtttttgatggggcaatccataactgattataattataaaaagcccttacagaacgatca
ccaaattttagatgaaagtaaaaattttggttcaaatagtggatctttcgtcatgtacagcatgaagaaagacaaatact
atatttataatgaaaaagaaagtagaaaaagatattctcctgattcaacttataaaatttatttagcgatgtttggactt
gaccgtcatatcataagtgataaaaattcacgtatgtcatggaatcataaacattatcctttcgagtcttggaataagga
acaagatttaaatacagcaatgcaaaattcagttaattggtacttcgaacgtattagtaatcaaataccaaagaactata
ctgcggctcaactcaagcaattaaattatggtaatgaaaatttgggaagttataaaaactattggatggaagatagtttg
aaaatatctaatcttgaacaagtaatagtttttaaaaatatgatggaacaaaataaccattttagtaaaaaagcaaagaa
tcaattatcttcttcattattgattaagaaaaatgaaaagtatgaactgtatgggaaaacaggtacaggtatagtaaacg
ggaagtataataatgggtggtttgtaggttacgtaattacaaatcatgataagtattattttgctacacatttatcagat
ggaaacccgtctgggaaaaatgctgaattaatcagtgaaaaaatattaaaagaaatgggtgttttaaatggccaataa

>>MEG_1300|Drugs|betalactams|Penicillin_binding_protein_regulator|BLAR
atggctaaattactaataatgagcgtagtaagcttttgttttatatttctattgttagtattttttaggtatatattaaa
acgctattttaattatagtttaaattataaagtttggtatctaactgtgcttgctggattaattccttttatcccaatta
aattctcttttataaaatttaataatgtgaataatcaatcgcccacagttgaaagtaggtcacacgacttgaaccataac
ataaataccaccaaacctgttcaagagttcacaacagatatccataagtttaattgggattcaattgataatatctgcac
agttatttggatagttttggttattattttaagttttaaatttttgaaatccttattatatcttaaatatttaaagagac
agtcactttatctaaacgaaaatgaaaaaaataaaatagatacgatacttttcaaccatcaatataaaaaaaatattgtg
attcgaaaagcagagactattcaatctccaataactttttggtatgggaaatatattattttgattcctagttcatattt
taaaagtgtaattgacaaaagactaaaatatataatattgcatgaatatgctcatgctaaaaatagagatactttacatt
taattatctttaatatcttctctattgttatgagttacaatccattaatacatattgtaaaaagaaagataattcatgac
aatgaagtagaagccgatagatttgttcttaataatattaacaaaaatgaatttaaaacttatgcggaatctattatgga
ctccgtattaaatattccattttttaataaaaatatattaagccattcatttaatggtaaaaagtcattactcaaaagaa
gattaattaatataaaagaagccaatttgaaaaaacagtccaaattaattccaatttttatttgtatttttacttttttg
ctcatggtaattcaaagccagtttttgatggggcaatccataactgattataattataaaaagcccttacagaacgatca
ccaaattttagatgaaagtaaaaattttggttcaaatagtggatctttcgtcatgtacagcatgaagaaagacaaatact
atatttataatgaaaaagaaagtagaaagagatattctcctgattcaacttataaaatttatttagcgatgtttggactt
gaccatcatatcataagtgataaaaattcacgtatgtcatggaatcataaacattatcctttcgagtcttggaataagga
acaagatttaaatacagcaatgcaaaattcagttaattggtacttcgaacgtattagtaatcaaataccaaagaactata
ctgcggctcaactcaagcaattaaattatggtaatgaaaacttgggaagttataaaagctattggatggaagatagtttg
aaaatatctaatcttgaacaagtaatagtttttaaaaatatgatggaacaaaataaccattttagtaaaaaagcaaagaa
tcaattatcttcttcattattgattaagaaaaatgaaaagtatgaactgtatgggaaaacaggtacaggtatagtaaacg
ggaagtataataatgggtggtttgtaggttacgtaattacaaatcatgataagtattattttgctacacatttatcagat
ggaaagccgtctgggaaaaatgctgaattaatcagtgaaaaaatattaaaagaaatgggtgttttaaatggccaataa

>>MEG_1301|Drugs|betalactams|Penicillin_binding_protein_regulator|BLAR
atggctaagttattaataatgagcatagtaagcttttgttttatatttctattggtattattttttaggtacatattaaa
acgctattttaattatatgttaaattataaagtttggtatctaactcttcttgcaggattaattcctttcattcctatta
aattctctctttttaaatttaataatgtgaataatcaagcgcccacagttgaaagtaagtcacacgacttgaaccataac
ataaataccaccaaacctattcaagagttcgcaacagatatccataagtttaattgggattcaattgataatatctgcac
agttatttggatagttttagttattattttaagttttaaatttttgaaagccttattatatcttaaatatttaaagaaac
agtcactttatctaaacgaaaatgaaaaaaataaaatagatacgatacttttcaaccatcaatataaaaaaaatattgtg
attcgaaaagcagagactattcaatctccaataactttttggtatgggaaatatattattttgattcctagttcatattt
taaaagtgtaattgacaaaagactaaaatatataatattgcatgaatatgctcatgctaaaaatagagatactttacatt
taattatctttaatatcttctctattattatgagttacaatccattagtacatattgtaaaaagaaagataattcatgac
aatgaagtagaagccgatagatttgtccttaataatattaacaaaaatgaatttaaaacttatgcggaatctattatgga
ctccgtattaaatgttccattttttaataaaaatatattaagccattcatttaatggtaaaaagtcattactcaaaagaa
gattaattaatataaaagaagccaatctgaaaaaacagtccaaattaattctaatttttatttgtatttttacttttttg
ctcatggtaattcaaagccagtttttgatggggcaatccataactgattataattataaaaagcccttacacaacgatta
ccaaattttagataaaagtaaaatttttggttcaaatagtggatctttcgtcatgtacagcatgaagaaagacaaatact
atatttataacgaaaaagaaagtagaaaaaggtattctcctaattcaacttataaaatttatttagctatgtttggactt
gaccgacatattataaatgatgaaaattcacgtatgtcatggaatcataagcattacccttttgatgcttggaataagga
acaagatttaaatacagcaatgcaaaattcagttaattggtacttcgaacgtattagcgatcaaataccaaagaactata
ctgcgactcaactcaagcaattaaattatggtaataaaaatttgggaagttataaaagctattggatggaagatagtttg
aaaatatctaatcttgaacaagtaatagtttttaaaaatatgatggaacaaaataaccattttagtaaaaaagcaaagaa
tcaattatcttcttcattattgattaagaaaaatgaaaagtatgaactgtatgggaaaacaggtacaggtatagtaaacg
ggaagtataataatgggtggtttgtaggttacgtaattacaaatcatgataagtattattttgctacacatttatcagat
ggaaagccgtctgggaaaaatgctgaattaatcagtgaaaaaatattaaaagaaatgggtgttttaaatggccaataa

>>MEG_1302|Drugs|betalactams|Penicillin_binding_protein_regulator|BLAR
atggctaagttattaataatgagcatagtaagcttttgttttatatttctattgttattattttttaggtacatattaaa
acgctattttaattatatgttaaattataaagtttggtatctaactcttcttgcaggattaattcctttcattcctatta
aattctctctttttaaatttaataatgtgaataatcaagcgcccacagttgaaagtaagtcacacgacttgaaccataac
ataaataccaccaaacctattcaagagttcacaacagatatccataagtttaattgggattcaattgataatatctgcac
agttatttggatagttttagttattattttaagttttaaatttttgaaagccttattatatcttaaatatttaaagaaac
agtcactttatctaaacgaaaatgaaaaaaataaaatagatacgatacttttcaaccatcaatataaaaaaaatattgtg
attcgaaaagcagagactattcaatctccaataactttttggtatgggaaatatattattttgattcctagttcatattt
taaaagtgtaattgacaaaagactaaaatatataatattgcatgaatatgctcatgctaaaaatagagatactttacatt
taattatctttaatatcttctctattattatgagttacaatccattagtacatattgtaaaaagaaagataattcatgac
aatgaagtagaagccgatagatttgtccttaataatattaacaaaaatgaatttaaaacttatgcggaatctattatgga
ctccgtattaaatgttccattttttaataaaaatatattaagccattcatttaatggtaaaaagtcattactcaaaagaa
gattaattaatataaaagaagccaatctgaaaaaacagtccaaattaattctaatttttatttgtatttttacttttttg
ctcatggtaattcaaagccagtttttgatggggcaatccataactgattataattataaaaagcccttacacaacgatta
ccaaattttagataaaagtaaaatttttggttcaaatagtggatctttcgtcatgtacagcatgaagaaagacaaatact
atatttataacgaaaaagaaagtagaaaaaggtattctcctaattcaacttataaaatttatttagctatgtttggactt
gaccgacatattataaatgatgaaaattcacgtatgtcatggaatcataagcattacccttttgatgcttggaataagga
acaagatttaaatacagcaatgcaaaattcagttaattggtacttcgaacgtattagcgatcaaataccaaagaactata
ctgcgactcaactcaagcaattaaattatggtaataaaaatttgggaagttataaaagctattggatggaagatagtttg
aaaatatctaatcttgaacaagtaatagtttttaaaaatatgatggaacaaaataaccattttagtaaaaaagcaaagaa
tcaattatcttcttcattattgattaagaaaaatgaaaagtatgaactgtatgggaaaacaggtacaggtatagtaaacg
ggaagtataataatgggtggtttgtaggttacgtaattacaaatcatgataagtattattttgctacacatttatcagat
ggaaagccatctgggaaaaatgctgaattaatcagtgaaaaaatattaaaagaaatgggtgttttaaatggccaataa

>>MEG_1303|Drugs|betalactams|Penicillin_binding_protein_regulator|BLAR
ATGACGTTACCGCATATTTTACTTTCTCTTGTATTAATAACGGCAACGATTCTAGTGATCTTTTTTGTAAGAGCGGTTTT
TTATAAACAATTATCAGCAAAATGGCGTTATCATTTATGGTTTTTACTCATTACTGTGTTGACGCTTCCGTTTATACCGA
TTCATCTATTGACGGGCTTGTCTTTTTTTGACCAGGGGCGTCAACAGATTACCCCTTCAGCACAGAAGCGTTTCGGTTTT
GCGGATCAAAATGAGCAATGGATGGTTGATTTTGGCACGTCTGTTAGTCGCTTTGACGATACATTCATTCATGCAGTGTT
TGTTTCCATCTGGATTGGTGGAATGATTTTTTTCCTTTTATTGACTTTATACCATTATGCAAAGCTACAACGACTAGTAA
AAGCGGCAAGTCGTATACAAAATCAAAAAGTCGAAAACGCGTTTAGCGATTGTATGGCAGAATTGCAAATAACGAATAAA
TTAACCAATTTAGAATCCCCTGCCATTCAAACGCCAATGACCTTTGGATGGTTAAAGACGTACATCTTGTTGCCCAAAAA
TATCGAATTGTATCTATCTGATGATGAAATCAGACATGTGTTGTTGCATGAGTTGCACCATTATAAAAGCAAACATATTA
AAGTGAACTATATATTTGTCGTTTACCAAATTGTTTATTGGTTTCATCCTTTAGTATGGAAAGCCTTTAAAGAGATGCGT
CTTGATCGGGAATTAGCTTGTGATACGGAGGTCTTGCTTACATTGGGACAGCGGGAGTATAAAGCGTATGGCCAGACGAT
CATGCGTTTTCTGGAAAGAAATTCTCGATTTTTATACTTAACGAACCCACTGCATAGTTCGAAAAAAGCTTTTAAAAATA
CGAAATCTTATAACATTGCTTTCTTTTACTGGCGAGTCAAAAGCGGCGCCCAATTAAAAAAGCCATGGGTGGTTTTTGCT
GGTCTCACCCGTTTTTGCATTGCTCAATTTCCTTTTTTAACGGCAACCGCTGTTTCTACAGAGCGCTACCAATTTGATGA
AAGCCAGGCGGTTGTTGAAGATTACAGCACTTATTTTGCAGGAAATGAGGGTAGTTTTGTATTATATAGCTTAACCAGCG
ACCAGTTCGAAATCTATAATAAAGAAAAAAGTGTAAGAAGAGTCTCCCCCAATTCTTCCTATAAAATTTACACCGCGCTC
ATGGCATTGGAACTAGGCGTGATTGGGCGAGATGATTCATGGTTAGAGTGGGATGGAGTCGAATACGAGGATGAAGCCTG
GAATAGCGGGCAAGATTTGAAATCGGCGATGAGCCAGTCAGTCACTTGGTACTTTCAAGAGTTAGACGAGCGGATCAAAC
AAAGGAACATCCAATCTTTTGTAAACCAATTAGACTATGGGAATAAAGATCTTTCCGGTGGATTAAATCACTATTGGCTG
GAATCTTCCTTGAAAATATCACCGGTAGAACAAGTGGAGCTTCTCCATTCCTTCTATACAAACCAACTGGACTTTAAAGA
AGAGCATGTGCAATTCGTTAAAGAGGTTATGAAACTTGAAGAAAATCAAAAGGGAACGCTTTATGGAAAAACCGGGACTG
GCATTGTGAACGGCCATGCAATAAATGGTTGGTTTATTGGATTTGTCGAAACTGAAACGGATACGTACTTTTTTGCGACA
AACATTCAACAGAAGATCATGCATATGGAAGCACGGCTGCTGAAATCACTTTATCCATTCTGTCAAGCAAAGGAATTTAT
TGATTAG