MEGAResFrom MEG, the Microbial Ecology Group

BLAR

The BlaR gene is a sensor-transducer that inhibits the production of PBP2a when beta-lactams are present. This results in fewer targets for the drug to bind and resistance to the beta-lactam antibiotic.

References

Other Groups in Penicillin binding protein regulator

Sequences

Download Sequences

>CARD|phgb|EF540343|1463-3230|ARO:3000217|blaR1|betalactams|Penicillin_binding_protein_regulator|BLAR
CTAATCAATAAATTCCTTTGCTTGACAGAATGGATAAAGTGATTTCAGCAGCCGTGCTTCCATATGCATGATCTTCTGTT
GAATGTTTGTCGCAAAAAAGTACGTATCCGTTTCAGTTTCGACAAATCCAATAAACCAACCATTTATTGCATGGCCGTTC
ACAATGCCAGTCCCGGTTTTTCCATAAAGCGTTCCCTTTTGATTTTCTTCAAGTTTCATAACCTCTTTAACGAATTGCAC
ATGCTCTTCTTTAAAGTCCAGTTGGTTTGTATAGAAGGAATGGAGAAGCTCCACTTGTTCTACCGGTGATATTTTCAAGG
AAGATTCCAGCCAATAGTGATTTAATCCACCGGAAAGATCTTTATTCCCATAGTCTAATTGGTTTACAAAAGATTGGATG
TTCCTTTGTTTGATCCGCTCGTCTAACTCTTGAAAGTACCAAGTGACTGACTGGCTCATCGCCGATTTCAAATCTTGCCC
GCTATTCCAGGCTTCATCCTCGTATTCGACTCCATCCCACTCTAACCATGAATCATCTCGCCCAATCACGCCTAGTTCCA
ATGCCATGAGCGCGGTGTAAATTTTATAGGAAGAATTGGGGGAGACTCTTCTTACACTTTTTTCTTTATTATAGATTTCG
AACTGGTCGCTGGTTAAGCTATATAATACAAAACTACCCTCATTTCCTGCAAAATAAGTGCTGTAATCTTCAACAACCGC
CTGGCTTTCATCAAATTGGTAGCGCTCTGTAGAAACAGCGGTTGCCGTTAAAAAAGGAAATTGAGCAATGCAAAAACGGG
TGAGACCAGCAAAAACCACCCATGGCTTTTTTAATTGGGCGCCGCTTTTGACTCGCCAGTAAAAGAAAGCAATGTTATAA
GATTTCGTATTTTTAAAAGCTTTTTTCGAACTATGCAGTGGGTTCGTTAAGTATAAAAATCGAGAATTTCTTTCCAGAAA
ACGCATGATCGTCTGGCCATACGCTTTATACTCCCGCTGTCCCAATGTAAGCAAGACCTCCGTATCACAAGCTAATTCCC
GATCAAGACGCATCTCTTTAAAGGCTTTCCATACTAAAGGATGAAACCAATAAACAATTTGGTAAACGACAAATATATAG
TTCACTTTAATATGTTTGCTTTTATAATGGTGCAACTCATGCAACAACACATGTCTGATTTCATCATCAGATAGATACAA
TTCGATATTTTTGGGCAACAAGATGTACGTCTTTAACCATCCAAAGGTCATTGGCGTTTGAATGGCAGGGGATTCTAAAT
TGGTTAATTTATTCGTTATTTGCAATTCTGCCATACAATCGCTAAACGCGTTTTCGACTTTTTGATTTTGTATACGACTT
GCCGCTTTTACTAGTCGTTGTAGCTTTGCATAATGGTATAAAGTCAATAAAAGGAAAAAAATCATTCCACCAATCCAGAT
GGAAACAAACACTGCATGAATGAATGTATCGTCAAAGCGACTAACAGACGTGCCAAAATCAACCATCCATTGCTCATTTT
GATCCGCAAAACCGAAACGCTTCTGTGCTGAAGGGGTAATCTGTTGACGCCCCTGGTCAAAAAAAGACAAGCCCGTCAAT
AGATGAATCGGTATAAACGGAAGCGTCAACACAGTAATGAGTAAAAACCATAAATGATAACGCCATTTTGCTGATAATTG
TTTATAAAAAACCGCTCTTACAAAAAAGATCACTAGAATCGTTGCCGTTATTAATACAAGAGAAAGTAAAATATGCGGTA
ACGTCATC

>61|unknown_id|unknown_name|betalactams|Penicillin_binding_protein_regulator|BLAR
ATGACGTTACCGCATATTTTACTTTCTCTTGTATTAATAACGGCAACGATTCTAGTGATCTTTTTTGTAAGAGCGGTTTT
TTATAAACAATTATCAGCAAAATGGCGTTATCATTTATGGTTTTTACTCATTACTGTGTTGACGCTTCCGTTTATACCGA
TTCATCTATTGACGGGCTTGTCTTTTTTTGACCAGGGGCGTCAACAGATTACCCCTTCAGCACAGAAGCGTTTCGGTTTT
GCGGATCAAAATGAGCAATGGATGGTTGATTTTGGCACGTCTGTTAGTCGCTTTGACGATACATTCATTCATGCAGTGTT
TGTTTCCATCTGGATTGGTGGAATGATTTTTTTCCTTTTATTGACTTTATACCATTATGCAAAGCTACAACGACTAGTAA
AAGCGGCAAGTCGTATACAAAATCAAAAAGTCGAAAACGCGTTTAGCGATTGTATGGCAGAATTGCAAATAACGAATAAA
TTAACCAATTTAGAATCCCCTGCCATTCAAACGCCAATGACCTTTGGATGGTTAAAGACGTACATCTTGTTGCCCAAAAA
TATCGAATTGTATCTATCTGATGATGAAATCAGACATGTGTTGTTGCATGAGTTGCACCATTATAAAAGCAAACATATTA
AAGTGAACTATATATTTGTCGTTTACCAAATTGTTTATTGGTTTCATCCTTTAGTATGGAAAGCCTTTAAAGAGATGCGT
CTTGATCGGGAATTAGCTTGTGATACGGAGGTCTTGCTTACATTGGGACAGCGGGAGTATAAAGCGTATGGCCAGACGAT
CATGCGTTTTCTGGAAAGAAATTCTCGATTTTTATACTTAACGAACCCACTGCATAGTTCGAAAAAAGCTTTTAAAAATA
CGAAATCTTATAACATTGCTTTCTTTTACTGGCGAGTCAAAAGCGGCGCCCAATTAAAAAAGCCATGGGTGGTTTTTGCT
GGTCTCACCCGTTTTTGCATTGCTCAATTTCCTTTTTTAACGGCAACCGCTGTTTCTACAGAGCGCTACCAATTTGATGA
AAGCCAGGCGGTTGTTGAAGATTACAGCACTTATTTTGCAGGAAATGAGGGTAGTTTTGTATTATATAGCTTAACCAGCG
ACCAGTTCGAAATCTATAATAAAGAAAAAAGTGTAAGAAGAGTCTCCCCCAATTCTTCCTATAAAATTTACACCGCGCTC
ATGGCATTGGAACTAGGCGTGATTGGGCGAGATGATTCATGGTTAGAGTGGGATGGAGTCGAATACGAGGATGAAGCCTG
GAATAGCGGGCAAGATTTGAAATCGGCGATGAGCCAGTCAGTCACTTGGTACTTTCAAGAGTTAGACGAGCGGATCAAAC
AAAGGAACATCCAATCTTTTGTAAACCAATTAGACTATGGGAATAAAGATCTTTCCGGTGGATTAAATCACTATTGGCTG
GAATCTTCCTTGAAAATATCACCGGTAGAACAAGTGGAGCTTCTCCATTCCTTCTATACAAACCAACTGGACTTTAAAGA
AGAGCATGTGCAATTCGTTAAAGAGGTTATGAAACTTGAAGAAAATCAAAAGGGAACGCTTTATGGAAAAACCGGGACTG
GCATTGTGAACGGCCATGCAATAAATGGTTGGTTTATTGGATTTGTCGAAACTGAAACGGATACGTACTTTTTTGCGACA
AACATTCAACAGAAGATCATGCATATGGAAGCACGGCTGCTGAAATCACTTTATCCATTCTGTCAAGCAAAGGAATTTAT
TGATTAG