MEGAResFrom MEG, the Microbial Ecology Group

BLAI

The blaI gene is a BlaZ repressor. It has been shown that inhibition of BlaI results in sensitivity to natural antimicrobial peptides.

References

Other Groups in Penicillin binding protein regulator

Sequences

Download Sequences

>CARD|phgb|EF540343|1059-1440|ARO:3000160|blaI|betalactams|Penicillin_binding_protein_regulator|BLAI
TTATTCTTTCCGTTTTTGATCTAAGATCGCATACAGTTCATCCAGCTCTTCTTTTGTTAGTGACTCTTCCTCCAAGAACT
GGACCAACAATGGTTTTACTGTTCCCCCGTAAACTCTCTTTACGAAAGACTGTGCTTCTGCATGCTTACACGCTTCTTCT
GAGTATAGGGGAAAGAAGACATAGATTTTCTGCTCTTTATCTACGCCTACTACTTTCTTCTTCGTTAATCGATCGAGTAA
CGTCCGAATCGTTTTTGGTTTCCAGTCCGTTTGCTCTTGGATCGCGGAAATGACTTGATTGGCTGTTTGCGGCCCCTTTT
TCCACAAAACTTTCATAACTTCCCATTCTGCTTCCGATATGCTAGGTGTTTGGTTTGACATC

>60|unknown_id|unknown_name|betalactams|Penicillin_binding_protein_regulator|BLAI
ATGTCAAACCAAACACCTAGCATATCGGAAGCAGAATGGGAAGTTATGAAAGTTTTGTGGAAAAAGGGGCCGCAAACAGC
CAATCAAGTCATTTCCGCGATCCAAGAGCAAACGGACTGGAAACCAAAAACGATTCGGACGTTACTCGATCGATTAACGA
AGAAGAAAGTAGTAGGCGTAGATAAAGAGCAGAAAATCTATGTCTTCTTTCCCCTATACTCAGAAGAAGCGTGTAAGCAT
GCAGAAGCACAGTCTTTCGTAAAGAGAGTTTACGGGGGAACAGTAAAACCATTGTTGGTCCAGTTCTTGGAGGAAGAGTC
ACTAACAAAAGAAGAGCTGGATGAACTGTATGCGATCTTAGATCAAAAACGGAAAGAATAA