MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

BLAI

The blaI gene is a BlaZ repressor. It has been shown that inhibition of BlaI results in sensitivity to natural antimicrobial peptides.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4549145/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Penicillin binding protein regulator

Sequences

Download Sequences

>>MEG_1287|Drugs|betalactams|Penicillin_binding_protein_regulator|BLAI
atggccaataagcaagttgaaatatctatggctgaatgggatgttatgaatataatatggggtaaaaaatcagtatcagc
taatgaaattgtagttgaaattcaaaaatataaagaagttagcgataaaacgattagaacattaatcacaagactatata
aaaaagagattataaaacgatacaaatcagagaatatttatttttactcatcaaatattaaagaagacgatattaaaatg
aaaactgctaaaacctttcttaataaactgtatggaggggacatgaaaagtttagtgctgaattttgcgaaaaatgaaga
attaaataacaaagaaattgaagaattgcgagacattttaaatgatattagtaaaaagtaa

>>MEG_1288|Drugs|betalactams|Penicillin_binding_protein_regulator|BLAI
ATGAATATGAATGGACCTGCATCAATGGCGCAAAAAGAAAGACTTCAAACTTGCCAAGAAATTGCCAAGAGATTACACGA
GGTTTATGGCAACGACGTTCTCGCCATTGGCGTCTACGGTTCTGTGTCCAGAGGCACAGATGGCCCTTTCTCAGATATTG
AGATGTTTTGCGTACTCCGTGACTCGGCTGAAACGGTAGATAAAAGTTATGAATGGTCAGCTGGACCGTGGAAAGCGGAA
GTTAACGTTTGCAGTGCGAGTATACTGTTAAAAGACGCTGCAACCGTTGAAGACCGATGGCCGCTGACACATGGGCCTTA
CTTCTCTCCGCTTCGTCTCTATGATCCTGAAGGCTTCTTTCAACGCTTGCGGCTCGCAGCGGAATCGCCGACAAAAGAAG
ATTTCCGCCAAGCTATTCATGAAATTCTTGTAGGGGAAATGTATGAATATGTTGGCAAGCTTCGAAATGTAAATCGAAAT
GGCCCTTCTACCTACTTGCCATCCTTGGCATTGCGCTTTGCCCACTATGGCGCAATGTTGATCGGCCTCCACAATCAGAC
ACTCTTTTCTACGGGCGCTATGGTTTTGCCTGAAGCGCTGAAACTGCCGCATCGGCCAAAAGGGTTCGACCATGTTGCTG
AGTTAGCGATGTCTGGAGACTTAGCACAACCAGCGAAGATCGTGTCAGCGTGCGAAGATTTCTGGAAAGGCCTAGTCGCG
TGGGCAGCGGAGCATGATTACGTCATTCACTCAAAACGAATCCCGTTTTGA

>>MEG_1289|Drugs|betalactams|Penicillin_binding_protein_regulator|BLAI
ATGTCAAACCAAACACCTAGCATATCGGAAGCAGAATGGGAAGTTATGAAAGTTTTGTGGAAAAAGGGGCCGCAAACAGC
CAATCAAGTCATTTCCGCGATCCAAGAGCAAACGGACTGGAAACCAAAAACGATTCGGACGTTACTCGATCGATTAACGA
AGAAGAAAGTAGTAGGCGTAGATAAAGAGCAGAAAATCTATGTCTTCTTTCCCCTATACTCAGAAGAAGCGTGTAAGCAT
GCAGAAGCACAGTCTTTCGTAAAGAGAGTTTACGGGGGAACAGTAAAACCATTGTTGGTCCAGTTCTTGGAGGAAGAGTC
ACTAACAAAAGAAGAGCTGGATGAACTGTATGCGATCTTAGATCAAAAACGGAAAGAATAA