MEGAResFrom MEG, the Microbial Ecology Group

MECB

The mecA gene and its homologues, mecB and mecC, encode PBP2a, which is part of the SCCmec resistance island. The PBP2a has a lower affinity for beta-lactam antibiotics and retains wild-type function of the PBPs, therefore causing resistance to beta-lactams. MecA is often present with its regulators MecR1 and MecI in the mec gene complex IS431-mecA-mecR1-mecI, however variants of this complex exist where mecR1 has been deleted or the genes are in a different order.

References

Other Groups in Penicillin binding protein

Sequences

Download Sequences

>CARD|phgb|AB498758|3738-5762|ARO:3003440|mecB|betalactams|Penicillin_binding_protein|MECB
ATGAAAAATAAAGCTTTAGCAATTTTAATTATATGTATTTGCCTTTTAATAGCATATAATTTTGTGAAAAAAGATGAAGT
TGATAAAATATTTGATGCTATTGAATTAAGGGATTCGGAATATCTGAATGAACATGCGACATTCTTATCTAAAAGTCTTT
ACGACAAAGATCAGAGATATAAAAGAATGGATAAGATTGATGCTTCTCTTGGTATTAAAGAAGTGAAAGTTAGTAATGTA
CGACTCGTGCAAAAGAAAAAAAATAAACGTCAATATAGTGCAAATTTAAATTTTAGAACTAAATATGGTAATTTTTCTAG
AGAAGGGAACTATTCTTTTGAAAAGGATGAAATAACAAAAAAATGGCTTTTGGATTGGTCACCTGAGGTTATAATACCGG
GATTGACTGATAGAAATCAAATCAGTATAGAAACCTTGGAATCTTTCAGAGGGAAAATACTAGACAGAAACGGGATTGAT
ATAGCGAAAGACGGAATTCATTACGAAGTTGGAATAGATATTAAAAATTTAAATAAAAAAAATAAGAAAAATATTTCAAA
ATTGTTATCAATAAGTGAATCGACACTAAATAAAAAGTTAAAACAAACATGGGTAAAAGAAGGTGTTTTTTTACCTTTAA
AATCGTACATAGAGTTGGATGATGAACTTAAATTGGGTATCCAAAAATATCATTTGACGGTTAATCAAACAAAAGGTAGG
GTTTATCCATTAAGAGAAGCAACAGTACATCTTTTAGGGTATGTTGGAGAAATTAATGCTGAAGAATTAAAGAATAAAAA
GTTTAAGGATTATGATGAACACTCAATCGTAGGAAAAAGTGGTATCGAACTACAATATGATAAACAATTGCAAAATAAAG
ATGGTTATAAAGTTGTCATAACTAGTGATGATGCATTAAATAATGATGAAGATGTCTTGTTAGAAAAGAAACCAAAAAAT
GGACAGGACATTATATTAACAATTGATAGCAAAGTACAAAGAAGTATATATAGTCATTTAAAAGAAGATAATGGTTCAGG
AGTAGCCATGAATCCTAAAACTGGTGAATTATTAGCTTTAGTTAGTTATCCTGCATATGACCCCTATGAGTTTATGTTCG
GCATTTCCGACGAAAACTACAAAAAGATAGTTAATGATAAGAAAGAGCCCCTGTTAAATAAATTTCAGACAACCTCTTCC
CCAGGATCTACTCAGAAATTAATAACATCTATCATAGGTTTGAAAAATGGGACTATAGACGCATCAACCAGCTACAACAT
AGTAACTAAGGGATGGCAGAGAAATTCTTCATGGGGAGGATATGAAGTTACAAGGTTTGAGGAAGTTAATGGAGATATTG
ATTTAGAAAAAGCGATAGCACATTCTGATAATATATTTTTTGCAAGAGCTACCCTCGATATGGGTTCCGAAAAATTTATT
AAGGGCATGAAAGCTTTAGACATTGGGAGAAATATTCCTTCTGATTATTATTTTCAAAAAGGACAAATTGCAAATCCAGA
AAGTTTAAAAAATAATTTTAAAAATGAAATATTACTAGCTGATTCAGGATATGGCCAGGGAGAAATACTTATAAGTCCAG
TACAAATATTATCTATTTATAGTTCTTTAATTAATGAAGGTAAAATGATGAAACCTAAATTATTTGAAACAACAAAAGAA
GATATTTGGAAAAATCATATTATTTCAAAAGATGACGTAGATATATTAACAAGAAGCATGAGAAAAGTAGTTACTGGGAC
ACATAGATTGGATGCAGAAAGAAATTATGCACAGTTTGCTGGAAAAACTGGCACTGCAGAATTGAAAACCTCTAGAGAAG
AGGGGTTAGGAGCTCAAATCGGTTGGTTTGTTGGATATGATCAAAATAATCCCAATATGATGTTAGGTATAAGTGTGAAG
AATGTAGAGAATAAAGGTATGTCGAGTTATAATGCAAGAAAGTTTGCCGAGATAATGGATGAATTATATGAAAATGGAAC
GAAAAAATATGAAATAGATAGGTGA