MEGAResFrom MEG, the Microbial Ecology Group

MECA

The mecA gene and its homologues, mecB and mecC, encode PBP2a, which is part of the SCCmec resistance island. The PBP2a has a lower affinity for beta-lactam antibiotics and retains wild-type function of the PBPs, therefore causing resistance to beta-lactams. MecA is often present with its regulators MecR1 and MecI in the mec gene complex IS431-mecA-mecR1-mecI, however variants of this complex exist where mecR1 has been deleted or the genes are in a different order.

References

Other Groups in Penicillin binding protein

Sequences

Download Sequences

>Bla|NC_009487.5167689|betalactams|Penicillin_binding_protein|MECA
GTGTTATCATCTTTTTTAATGTTAAGTATAATCAGTTCATTGCTCACGATATGTGTAATTTTTTTAGTGAGAATGCTCTA
TATAAAATATACTCAAAATATTATGTCACATAAGATTTGGTTATTAGTGCTCGTCTCCACGTTAATTCCATTAATACCAT
TTTACAAAATATCGAATTTTACATTTTCAAAAGATATGATGAATCGAAATGTATCTGACACGACTTCTTCGGTTAGTCAT
ATGTTAGATGGTCAACAATCATCTGTTACGAAAGACTTAGCAATTAATGTTAATCAGTTTGAGACCTCAAATATAACGTA
TATGATTCTTTTGATATGGGTATTTGGTAGTTTGTTGTGCTTATTTTATATGATTAAGGCATTCCGACAAATTGATGTTA
TTAAAAGTTCGTCATTGGAATCGTCATATCTTAATGAACGACTTAAAGTATGTCAAAGTAAGATGCAGTTCTACAAAAAG
CATATAACAATTAGTTATAGTTCAAACATTGATAATCCGATGGTATTTGGTTTAGTGAAATCCCAAATTGTACTACCAAC
TGTCGTAGTCGAAACCATGAATGACAAAGAAATTGAATATATTATTCTACATGAACTATCACATGTGAAAAGTCATGACT
TAATATTCAACCAGCTTTATGTTGTTTTTAAAATGATATTCTGGTTTAATCCTGCACTATATATAAGTAAAACAATGATG
GACAATGACTGTGAAAAAGTATGTGATAGAAACGTTTTAAAAATTTTGAATCGCCATGAACATATACGTTATGGTGAATC
GATATTAAAATGCTCTATTTTAAAATCTCAGCACATAAATAATGTGGCAGCACAATATTTACTAGGTTTTAATTCAAATA
TTAAAGAACGTGTTAAGTATATTGCACTTTATGATTCAATGCCTAAACCTAATCGAAACAAGCGTATTGTTGCGTATATT
GTATGTAGTATATCGCTTTTAATACAAGCACCGTTACTATCTGCACATGTTCAACAAGACAAATATGAAACAAATGTATC
ATATAAAAAATTAAATCAACTAGCTCCGTATTTCAAAGGATTTGATGGAAGTTTTGTGCTTTATAATGAACGGGAGCAAG
CTTATTCTATTTATAATGAACCAGAAAGTAAACAACGATATTCACCTAATTCTACTTACAAAATTTATTTAGCGTTAATG
GCATTCGACCAAAATTTACTCTCATTAAATCATACTGAACAACAATGGGATAAACATCAATATCCATTTAAAGAATGGAA
CCAAGATCAAAATTTAAATTCTTCAATGAAATATTCAGTAAATTGGTATTACGAAAATTTAAACAAACATTTAAGACAAG
ATGAGGTTAAATCTTATTTAGATCTAATTGAATATGGTAATGAAGAAATATCAGGGAATGAAAATTATTGGAATGAATCT
TCATTAAAAATTTCTGCAATAGAACAGGTTAATTTGTTGAAAAATATGAAACAACATAACATGCATTTTGATAATAAGGC
TATTGAAAAAGTTGAAAATAGTATGACTTTGAAACAAAAAGATACTTATAAATATGTAGGTAAAACTGGAACAGGAATCG
TGAATCACAAAGAAGCAAATGGATGGTTCGTAGGTTATGTTGAAACGAAAGATAATACGTATTATTTTGCTACACATTTA
AAAGGCGAAGACAATGCGAATGGCGAAAAAGCACAACAAATTTCTGAGCGTATTTTAAAAGAAATGGAATTAATATAA

>Bla|mecA_15_AB505628|betalactams|Penicillin_binding_protein|MECA
TTATTCATCTATATCGTATTTTTTATTACCGTTCTCATATAGCTCATCATACACTTTACCTGAGATTTTGGCATTGTAGC
TAGCCATTCCTTTATCTTGTACATCTTTAACATTAATAGCCATCATCATGTTTGGATTATCTTTATCATATGATATAAAC
CACCCAATTTGTCTGCCAGTTTCTCCTTGTTTCATTTTGAGTTCTGCAGTACCGGATTTGCCAATTAAGTTTGCATAAGA
TCTATAAATATCTTCTTTATGTGTTTTATTTACGACTTGTTGCATACCATCAGTTAATAGATTGATATTTTCTTTGGAAA
TAATATTTTTCTTCCAAACTTTGTTTTTCGTGTCTTTTAATAAGTGAGGTGCGTTAATATTGCCATTATTTTCTAATGCG
CTATAGATTGAAAGGATCTGTACTGGGTTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGCTAATAATATTTCATT
ATCTAAATTTTTGTTTGAAATTTGAGCATTATAAAATGGATAATCACTTGGTATATCTTCACCAACACCTAGTTTTTTCA
TGCCTTTTTCAAATTTCTTACTGCCTAATTCGAGTGCTACTCTAGCAAAGAAAATGTTATCTGATGATTCTATTGCTTGT
TTTAAGTCGATATTACCATTTACCACTTCATATCTTGTAACGTTGTAACCACCCCAAGATTTATCTTTTTGCCAACCTTT
ACCATCGATTTTATAACTTGTTTTATCGTCTAATGTTTTGTTATTTAACCCAATCATTGCTGTTAATATTTTTTGAGTTG
AACCTGGTGAAGTTGTAATCTGGAACTTGTTGAGCAGAGGTTCTTTTTTATCTTCGGTTAATTTATTATATTCTTCGTTA
CTCATGCCATACATAAATGGATAGACGTCATATGAAGGTGTGCTTACAAGTGCTAATAATTCACCTGTTTGAGGGTGGAT
AGCAGTACCTGAGCCATAATCATTTTTCATGTTGTTATAAATACTCTTTTGAACTTTAGCATCAATAGTTAGTTGAATAT
CTTTGCCATCTTTTTTCTTTTTCTCTATTAATGTATGTGCGATTGTATTGCTATTATCGTCAACGATTGTGACACGATAG
CCATCTTCATGTTGGAGCTTTTTATCGTAAAGTTTTTCGAGTCCCTTTTTACCAATAACTGCATCATCTTTATAGCCTTT
ATATTCTTTTTGTTTTAATTCTTCAGAGTTAATGGGACCAACATAACCTAATAGATGTGAAGTCGCTTTTCCTAGAGGAT
AGTTACGACTTTCTGTTTCATTAGTTGTAAGATGAAATTTTTTTGCGAAATCACTTAAATATTCATCCATTTTTTTAACG
GTTTTAAGTGGAACGAAGGTATCATCTTGTACCCAATTTTGATCCATTTGTTGTTTGATATAGTCTTCAGAAATACTTAG
TTCTTTAGCGATTGCTTTATAATCTTTTTTAGATACATTCTTTGGAACGATGCCTATCTCATATGCTGTTCCTGTATTGG
CCAATTCCACATTGTTTCGGTCTAAAATTTTACCACGTTCTGATTTTAAATTTTCAATATGTATGCTTTGGTCTTTCTGC
ATTCCTGGAATAATGACGCTATGATCCCAATCTAACTTCCACATACCATCTTCTTTAACAAAATTAAATTGAACGTTGCG
ATCAATGTTACCGTAGTTTGTTTTAATTTTATATTGAGCATCTACTCGTTTTTTATTTTTAGATACTTTTTTTATTTTAC
GATCCTGAATGTTTATATCTTTAACGCCTAAACTATTATATATTTTTATCGGACGTTCAGTCATTTCTACTTCACCATTA
TCGCTTTTAGAAATATAACTGCTATCTTTATAAACTTGTTTGAAATTTTTATCTTCAATTGCATCAATAGTATTATTAAT
TTCTTTATCTTTTGAAGCATAAAAATATATACCAAACCCGACAACTACAACTATTAAAATAAGTGGAACAATTTTTATCT
TTTTCATCAA

>Bla|MECA|AB221124|91-2097|2007|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGA
TAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCTA
AAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAATAGTTTAGGCGTTAAAGATATAAACATT
CAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAA
CATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTC
CAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTG
GAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCAC
TTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAGAAAGT
CGTAACTATCCTCTAGGAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAA
AGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATG
AAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGAT
GGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGG
TACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATG
GCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCA
CCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAAT
CGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCG
ACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAA
AAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAA
TTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAA
TCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATAT
TTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACAAA
TTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAGGA
ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGA
TGAATAA

>Bla|NC_002745.1122813|betalactams|Penicillin_binding_protein|MECA
GTGTTATCATCTTTTTTAATGTTAAGTATAATCAGTTCATTGCTCACGATATGTGTAATTTTTTTAGTGAGAATGCTCTA
TATAAAATATACTCAAAATATTATGTCACATAAGATTTGGTTATTAGTGCTCGTCTCCACGTTAATTCCATTAATACCAT
TTTACAAAATATCGAATTTTACATTTTCAAAAGATATGATGAATCGAAATGTATCTGACACGACTTCTTCGGTTAGTCAT
ATGTTAGATGGTCAACAATCATCTGTTACGAAAGACTTAGCAATTAATGTTAATCAGTTTGAGACCTCAAATATAACGTA
TATGATTCTTTTGATATGGGTATTTGGTAGTTTGTTGTGCTTATTTTATATGATTAAGGCATTCCGACAAATTGATGTTA
TTAAAAGTTCGTCATTGGAATCGTCATATCTTAATGAACGACTTAAAGTATGTCAAAGTAAGATGCAGTTCTACAAAAAG
CATATAACAATTAGTTATAGTTCAAACATTGATAATCCGATGGTATTTGGTTTAGTGAAATCCCAAATTGTACTACCAAC
TGTCGTAGTCGAAACCATGAATGACAAAGAAATTGAATATATTATTCTACATGAACTATCACATGTGAAAAGTCATGACT
TAATATTCAACCAGCTTTATGTTGTTTTTAAAATGATATTCTGGTTTAATCCTGCACTATATATAAGTAAAACAATGATG
GACAATGACTGTGAAAAAGTATGTGATAGAAACGTTTTAAAAATTTTGAATCGCCATGAACATATACGTTATGGTGAATC
GATATTAAAATGCTCTATTTTAAAATCTCAGCACATAAATAATGTGGCAGCACAATATTTACTAGGTTTTAATTCAAATA
TTAAAGAACGTGTTAAGTATATTGCACTTTATGATTCAATGCCTAAACCTAATCGAAACAAGCGTATTGTTGCGTATATT
GTATGTAGTATATCGCTTTTAATACAAGCACCGTTACTATCTGCACATGTTCAACAAGACAAATATGAAACAAATGTATC
ATATAAAAAATTAAATCAACTAGCTCCGTATTTCAAAGGATTTGATGGAAGTTTTGTGCTTTATAATGAACGGGAGCAAG
CTTATTCTATTTATAATGAACCAGAAAGTAAACAACGATATTCACCTAATTCTACTTACAAAATTTATTTAGCGTTAATG
GCATTCGACCAAAATTTACTCTCATTAAATCATACTGAACAACAATGGGATAAACATCAATATCCATTTAAAGAATGGAA
CCAAGATCAAAATTTAAATTCTTCAATGAAATATTCAGTAAATTGGTATTACGAAAATTTAAACAAACATTTAAGACAAG
ATGAGGTTAAATCTTATTTAGATCTAATTGAATATGGTAATGAAGAAATATCAGGGAATGAAAATTATTGGAATGAATCT
TCATTAAAAATTTCTGCAATAGAACAGGTTAATTTGTTGAAAAATATGAAACAACATAACATGCATTTTGATAATAAGGC
TATTGAAAAAGTTGAAAATAGTATGACTTTGAAACAAAAAGATACTTATAAATATGTAGGTAAAACTGGAACAGGAATCG
TGAATCACAAAGAAGCAAATGGATGGTTCGTAGGTTATGTTGAAACGAAAGATAATACGTATTATTTTGCTACACATTTA
AAAGGCGAAGACAATGCGAATGGCGAAAAAGCACAACAAATTTCTGAGCGTATTTTAAAAGAAATGGAGTTAATATAA

>Bla|KC243783.1|gene1|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGA
TAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCTA
AAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAATAGTTTAGGCGTTAAAGATATAAACATT
CAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAA
CATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTC
CAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTG
GAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCAC
TTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAAAAAGT
CGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAA
AGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATG
AAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGAT
GGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGG
TACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATG
GCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCA
CCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAAT
CGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCG
ACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAA
AAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAA
TTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAA
TCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATAT
TTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACAAA
TTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAGGA
ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGA
TGAATAA

>Bla|mecA_4_AB033763|betalactams|Penicillin_binding_protein|MECA
ATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAAAGA
TAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTTCTA
AAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAATAGTTTAGGCGTTAAAGATATAAACATT
CAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGGTAA
CATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTATTC
CAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAATGTG
GAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAATCGC
TAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTCCAC
TTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAGAAAGT
CGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAA
AGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATG
AAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAAGAT
GGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTCAGG
TACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGTATG
GCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACTTCA
CCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAAAAT
CGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATATCG
ACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTGAA
AAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAAAA
TTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTCAA
TCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGAAA
AATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGATAT
TTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACAAA
TTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAGGA
ATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATAGA
TGAATAA

>Bla|mecA_7_BA000018|betalactams|Penicillin_binding_protein|MECA
TTATTCATCTATATCGTATTTTTTATTACCGTTCTCATATAGCTCATCATACACTTTACCTGAGATTTTGGCATTGTAGC
TAGCCATTCCTTTATCTTGTACATCTTTAACATTAATAGCCATCATCATGTTTGGATTATCTTTATCATATGATATAAAC
CACCCAATTTGTCTGCCAGTTTCTCCTTGTTTCATTTTGAGTTCTGCAGTACCGGATTTGCCAATTAAGTTTGCATAAGA
TCTATAAATATCTTCTTTATGTGTTTTATTTACGACTTGTTGCATACCATCAGTTAATAGATTGATATTTTCTTTGGAAA
TAATATTTTTCTTCCAAACTTTGTTTTTCGTGTCTTTTAATAAGTGAGGTGCGTTAATATTGCCATTATTTTCTAATGCG
CTATAGATTGAAAGGATCTGTACTGGGTTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGCTAATAATATTTCATT
ATCTAAATTTTTGTTTGAAATTTGAGCATTATAAAATGGATAATCACTTGGTATATCTTCACCAACACCTAGTTTTTTCA
TGCCTTTTTCAAATTTCTTACTGCCTAATTCGAGTGCTACTCTAGCAAAGAAAATGTTATCTGATGATTCTATTGCTTGT
TTTAAGTCGATATTACCATTTACCACTTCATATCTTGTAACGTTGTAACCACCCCAAGATTTATCTTTTTGCCAACCTTT
ACCATCGATTTTATAACTTGTTTTATCGTCTAATGTTTTGTTATTTAACCCAATCATTGCTGTTAATATTTTTTGAGTTG
AACCTGGTGAAGTTGTAATCTGGAACTTGTTGAGCAGAGGTTCTTTTTTATCTTCGGTTAATTTATTATATTCTTCGTTA
CTCATGCCATACATAAATGGATAGACGTCATATGAAGGTGTGCTTACAAGTGCTAATAATTCACCTGTTTGAGGGTGGAT
AGCAGTACCTGAGCCATAATCATTTTTCATGTTGTTATAAATACTCTTTTGAACTTTAGCATCAATAGTTAGTTGAATAT
CTTTGCCATCTTTTTTCTTTTTCTCTATTAATGTATGTGCGATTGTATTGCTATTATCGTCAACGATTGTGACACGATAG
CCATCTTCATGTTGGAGCTTTTTATCGTAAAGTTTTTCGAGTCCCTTTTTACCAATAACTGCATCATCTTTATAGCCTTT
ATATTCTTTTTGTTTTAATTCTTCAGAGTTAATGGGACCAACATAACCTAATAGATGTGAAGTCGCTTTTCCTAGAGGAT
AGTTACGACTTTCTGTTTCATTAGTTGTAAGATGAAATTTTTTTGCGAAATCACTTAAATATTCATCCATTTTTTTAACG
GTTTTAAGTGGAACGAAGGTATCATCTTGTACCCAATTTTGATCCATTTGTTGTTTGATATAGTCTTCAGAAATACTTAG
TTCTTTAGCGATTGCTTTATAATCTTTTTTAGATACATTCTTTGGAACGATGCCTATCTCATATGCTGTTCCTGTATTGG
CCAATTCCACATTGTTTCGGTCTAAAATTTTACCACGTTCTGATTTTAAATTTTCAATATGTATGCTTTGGTCTTTCTGC
ATTCCTGGAATAATGACGCTATGATCCCAATCTAACTTCCACATACCATCTTCTTTAACAAAATTAAATTGAACGTTGCG
ATCAATGTTACCGTAGTTTGTTTTAATTTTATATTGAGCATCTACTCGTTTTTTATTTTTAGATACTTTTTTTATTTTAC
GATCCTGAATGTTTATATCTTTAACGCCTAAACTATTATATATTTTTATCGGACGTTCAGTCATTTCTACTTCACCATTA
TCGCTTTTAGAAATATAACTGCTATCTTTATAAACTTGTTTGAAATTTTTATCTTCAATTGCATCAATAGTATTATTAAT
TTCTTTATCTTTGGAAGCATAAAAATATATACCAAACCCGACAACTACAACTATTAAAATAAGTGGAACAATTTTTATCT
TTTTCAT

>Bla|mecA_14_AB505630|betalactams|Penicillin_binding_protein|MECA
TTGATGAAAAAGATAAAAATTGTTCCACTTATTTTAATAGTTGTAGTTGTCGGGTTTGGTATATATTTTTATGCTTCAAA
AGATAAAGAAATTAATAATACTATTGATGCAATTGAAGATAAAAATTTCAAACAAGTTTATAAAGATAGCAGTTATATTT
CTAAAAGCGATAATGGTGAAGTAGAAATGACTGAACGTCCGATAAAAATATATAATAGTTTAGGCGTTAAAGATATAAAC
ATTCAGGATCGTAAAATAAAAAAAGTATCTAAAAATAAAAAACGAGTAGATGCTCAATATAAAATTAAAACAAACTACGG
TAACATTGATCGCAACGTTCAATTTAATTTTGTTAAAGAAGATGGTATGTGGAAGTTAGATTGGGATCATAGCGTCATTA
TTCCAGGAATGCAGAAAGACCAAAGCATACATATTGAAAATTTAAAATCAGAACGTGGTAAAATTTTAGACCGAAACAAT
GTGGAATTGGCCAATACAGGAACAGCATATGAGATAGGCATCGTTCCAAAGAATGTATCTAAAAAAGATTATAAAGCAAT
CGCTAAAGAACTAAGTATTTCTGAAGACTATATCAAACAACAAATGGATCAAAATTGGGTACAAGATGATACCTTCGTTC
CACTTAAAACCGTTAAAAAAATGGATGAATATTTAAGTGATTTCGCAAAAAAATTTCATCTTACAACTAATGAAACAGAA
AGTCGTAACTATCCTCTAGAAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACA
AAAAGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAAC
ATGAAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATACATTAATAGAGAAAAAGAAAAAA
GATGGCAAAGATATTCAACTAACTATTGATGCTAAAGTTCAAAAGAGTATTTATAACAACATGAAAAATGATTATGGCTC
AGGTACTGCTATCCACCCTCAAACAGGTGAATTATTAGCACTTGTAAGCACACCTTCATATGACGTCTATCCATTTATGT
ATGGCATGAGTAACGAAGAATATAATAAATTAACCGAAGATAAAAAAGAACCTCTGCTCAACAAGTTCCAGATTACAACT
TCACCAGGTTCAACTCAAAAAATATTAACAGCAATGATTGGGTTAAATAACAAAACATTAGACGATAAAACAAGTTATAA
AATCGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATA
TCGACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTT
GAAAAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAA
AAATTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTT
CAATCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAG
AAAAATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCAACAAGTCGTAAATAAAACACATAAAGAAGA
TATTTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACAGGCAGAC
AAATTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAA
GGAATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATAT
AGATGAATAA

>672|AF181950.1|AF181950|betalactams|Penicillin_binding_protein|MECA
ATCGATGGTAAAGGTTGGCAAAAAGATAAATCTTGGGGTGGTTACAACGTTACAAGATATGAAGTGGTAAATGGTAATAT
CGACTTAAAACAAGCAATAGAATCATCAGATAACATTTTCTTTGCTAGAGTAGCACTCGAATTAGGCAGTAAGAAATTTG
AAAAAGGCATGAAAAAACTAGGTGTTGGTGAAGATATACCAAGTGATTATCCATTTTATAATGCTCAAATTTCAAACAAA
AATTTAGATAATGAAATATTATTAGCTGATTCAGGTTACGGACAAGGTGAAATACTGATTAACCCAGTACAGATCCTTTC
AATCTATAGCGCATTAGAAAATAATGGCAATATTAACGCACCTCACTTATTAAAAGACACGAAAAACAAAGTTTGGAAGA
AAAATATTATTTCCAAAGAAAATATCAATCTATTAACTGATGGTATGCCACAAGTCGTAAATAAAACACATAAAGAAGAT
ATTTATAGATCTTATGCAAACTTAATTGGCAAATCCGGTACTGCAGAACTCAAAATGAAACAAGGAGAAACTGGCAGACA
AATTGGGTGGTTTATATCATATGATAAAGATAATCCAAACATGATGATGGCTATTAATGTTAAAGATGTACAAGATAAAG
GAATGGCTAGCTACAATGCCAAAATCTCAGGTAAAGTGTATGATGAGCTATATGAGAACGGTAATAAAAAATACGATATA
GATGAATAA

>Bla|mecA_10_AB512767|betalactams|Penicillin_binding_protein|MECA
TTATTCATCTATATCGTATTTTTTATTACCGTTCTCATATAGCTCATCATACACTTTACCTGAGATTTTGGCATTGTAGC
TAGCCATTCCTTTATCTTGTACATCTTTAACATTAATAGCCATCATCATGTTTGGATTATCTTTATCATATGATATAAAC
CACCCAATTTGTCTGCCAGTTTCTCCTTGTTTCATTTTGAGTTCTGCAGTACCGGATTTGCCAATTAAGTTTGCATAAGA
TCTATAAATATCTTCTTTATGTGTTTTATTTACGACTTGTTGCATACCATCAGTTAATAGATTGATATTTTCTTTGGAAA
TAATATTTTTCTTCCAAACTTTGTTTTTCGTGTCTTTTAATAAGTGAGGTGCGTTAATATTGCCATTATTTTCTAATGCG
CTATAGATTGAAAGGATCTGTACTGGGTTAATCAGTATTTCACCTTGTCCGTAACCTGAATCAGCTAATAATATTTCATT
ATCTAAATTTTTGTTTGAAATTTGAGCATTATAAAATGGATAATCACTTGGTATATCTTCACCAACACCTAGTTTTTTCA
TGCCTTTTTCAAATTTCTTACTGCCTAATTCGAGTGCTACTCTAGCAAAGAAAATGTTATCTGATGATTCTATTGCTTGT
TTTAAGTCGATATTACCATTTACCACTTCATATCTTGTAACGTTGTAACCACCCCAAGATTTATCTTTTTGCCAACCTTT
ACCATCGATTTTATAACTTGTTTTATCGTCTAATGTTTTGTTATTTAACCCAATCATTGCTGTTAATATTTTTTGAGTTG
AACCTGGTGAAGTTGTAATCTGGAACTTGTTGAGCAGAGGTTCTTTTTTATCTTCGGTTAATTTATTATATTCTTCGTTA
CTCATGCCATACATAAATGGATAGACGTCATATGAAGGTGTGCTTACAAGTGCTAATAATTCACCTGTTTGAGGGTGGAT
AGCAGTACCTGAGCCATAATCATTTTTCATGTTGTTATAAATACTCTTTTGAACTTTAGCATCAATAGTTAGTTGAATAT
CTTTGCCATCTTTTTTCTTTTTCTCTATTAATGTATGTGCGATTGTATTGCTATTATCGTCAACGATTGTGACACGATAG
CCATCTTCATGTTGGAGCTTTTTATCGTAAAGTTTTTCGAGTCCCTTTTTACCAATAACTGCATCATCTTTATAGCCTTT
ATATTCTTTTTGTTTTAATTCTTCAGAGTTAATGGGACCAACATAACCTAATAGATGTGAAGTCGCTTTTCCTAGAGGAT
AGTTACGACTTTCTGTTTCATTAGTTGTAAGATGAAATTTTTTTGCGAAATCTCTTAAATATTCATCCATTTTTTTAACG
GTTTTAAGTGGAACGAAGGTATCATCTTGTACCCAATTTTGATCCATTTGTTGTTTGATATAGTCTTCAGAAATACTTAG
TTCTTTAGCGATTGCTTTATAATCTTTTTTAGATACATTCTTTGGAACGATGCCTATCTCATATGCTGTTCCTGTATTGG
CCAATTCCACATTGTTTCGGTCTAAAATTTTACCACGTTCTGATTTTAAATTTTCAATATGTATGCTTTGGTCTTTCTGC
ATTCCTGGAATAATGACGCTATGATCCCAATCTAACTTCCACATACCATCTTCTTTAACAAAATTAAATTGAACGTTGCG
ATCAATGTTACCGTAGTTTGTTTTAATTTTATATTGAGCATCTACTCGTTTTTTATTTTTAGATACTTTTTTTATTTTAC
GATCCTGAATGTTTATATCTTTAACGCCTAAACTATTATATATTTTTATCGGACGTTCAGTCATTTCTACTTCACCATTA
TCGCTTTTAGAAATATAACTGCTATCTTTATAAACTTGTTTGAAATTTTTATCTTCAATTGCATCAATAGTATTATTAAT
TTCTTTATCTTTTGAAGCATAAAAATATATACCAAACCCGACAACTACAACTATTAAAATAAGTGGAACAATTTTTATCT
TTTTCATCAA