MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

OPRD

The OprD porin plays a role in the transport of several beta-lactams, including carbapenem, through the bacterial outer membrane. Lower expression or mutation of OprD can reduce the permeability of beta-lactam antibiotics.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2696358/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Mutant porin proteins

Sequences

Download Sequences

>>MEG_4296|Drugs|betalactams|Mutant_porin_proteins|OPRD|RequiresSNPConfirmation
ATGAAAGTGATGAAGTGGAGCGCCATTGCACTGGCGGTTTCCGCAGGTAGCACTCAGTTCGCCGTGGCCGACGCATTCGT
CAGCGATCAGGCCGAAGCGAAGGGGTTCATCGAAGACAGCAGCCTCGACCTGCTGCTCCGCAACTACTATTTCAACCGTG
ACGGCAAGAGCGGCAGCGGGGACCGCGTCGACTGGACCCAAGGCTTCCTCACCACCTATGAATCCGGCTTCACCCAAGGC
ACTGTGGGCTTCGGCGTCGATGCCTTCGGCTACCTGGGCCTGAAGCTCGACGGCACCTCCGACAAGACCGGCACCGGCAA
CCTGCCGGTGATGAACGACGGCAAGCCGCGCGATGACTACAGCCGCGCCGGCGGCGCCGTGAAGGTGCGCATCTCCAAGA
CCATGCTGAAGTGGGGCGAGATGCAACCGACCGCCCCGGTCTTCGCCGCTGGCGGCAGCCGCCTGTTCCCGCAGACCGCG
ACCGGCTTCCAGCTGCAGAGCAGCGAATTCGAAGGGCTCGACCTCGAGGCAGGCCACTTCACCGAGGGCAAGGAGCCGAC
CACCGTCAAATCGCGTGGCGAACTCTATGCCACCTACGCAGGCGAGACCGCCAAGAGCGCCGATTTCATTGGGGGCCGCT
ACGCAATCACCGATAACCTCAGCGCCTCCCTGTACGGCGCCGAACTCGAAGACATCTATCGCCAGTATTACCTGAACAGC
AACTACACCATCCCACTGGCATCCGACCAATCGCTGGGCTTCGATTTCAACATCTACCGCACAAACGATGAAGGCAAGGC
CAAGGCCGGCGACATCAGCAACACCACTTGGTCCCTGGCGGCAGCCTACACTCTGGATGCGCACACTTTCACCTTGGCCT
ACCAGAAGGTCCATGGCGATCAGCCGTTTGATTATATCGGCTTCGGCCGCAACGGCTCTGGCGCAGGTGGCGACTCGATT
TTCCTCGCCAACTCTGTCCAGTACTCCGACTTCAACGGCCCTGGCGAGAAATCCTGGCAGGCTCGCTACGACCTGAACCT
AGCCTCCTATGGCGTTCCCGGCCTGACTTTCATGGTCCGCTATATCAATGGCAAGGACATCGATGGCACCAAGATGTCTG
ACAACAACGTCGGCTATAAGAACTACGGCTACGGCGAGGATGGCAAGCACCACGAAACCAACCTCGAAGCCAAGTACGTG
GTCCAGTCCGGTCCGGCCAAGGACCTGTCGTTCCGCATCCGCCAGGCCTGGCACCGTGCCAACGCCGACCAGGGCGAAGG
CGACCAGAACGAGTTCCGCCTGATCGTCGACTATCCGCTGTCGATCCTGTAA