MEGAResFrom MEG, the Microbial Ecology Group

OPRD

The OprD porin plays a role in the transport of several beta-lactams, including carbapenem, through the bacterial outer membrane. Lower expression or mutation of OprD can reduce the permeability of beta-lactam antibiotics.

References

Other Groups in Mutant porin proteins

Sequences

Download Sequences

>CARD|pvgb|NC_002516.2|1043982-1045314|ARO:3003686|oprD|betalactams|Mutant_porin_proteins|OPRD|RequiresSNPConfirmation
TTACAGGATCGACAGCGGATAGTCGACGATCAGGCGGAACTCGTTCTGGTCGCCTTCGCCCTGGTCGGCGTTGGCACGGT
GCCAGGCCTGGCGGATGCGGAACGACAGGTCCTTGGCCGGACCGGACTGGACCACGTACTTGGCTTCGAGGTTGGTTTCG
TGGTGCTTGCCATCCTCGCCGTAGCCGTAGTTCTTATAGCCGACGTTGTTGTCAGACATCTTGGTGCCATCGATGTCCTT
GCCATTGATATAGCGGACCATGAAAGTCAGGCCGGGAACGCCATAGGAGGCTAGGTTCAGGTCGTAGCGAGCCTGCCAGG
ATTTCTCGCCAGGGCCGTTGAAGTCGGAGTACTGGACAGAGTTGGCGAGGAAAATCGAGTCGCCACCTGCGCCAGAGCCG
TTGCGGCCGAAGCCGATATAATCAAACGGCTGATCGCCATGGACCTTCTGGTAGGCCAAGGTGAAAGTGTGCGCATCCAG
AGTGTAGGCTGCCGCCAGGGACCAAGTGGTGTTGCTGATGTCGCCGGCCTTGGCCTTGCCTTCATCGTTTGTGCGGTAGA
TGTTGAAATCGAAGCCCAGCGATTGGTCGGATGCCAGTGGGATGGTGTAGTTGCTGTTCAGGTAATACTGGCGATAGATG
TCTTCGAGTTCGGCGCCGTACAGGGAGGCGCTGAGGTTATCGGTGATTGCGTAGCGGCCCCCAATGAAATCGGCGCTCTT
GGCGGTCTCGCCTGCGTAGGTGGCATAGAGTTCGCCACGCGATTTGACGGTGGTCGGCTCCTTGCCCTCGGTGAAGTGGC
CTGCCTCGAGGTCGAGCCCTTCGAATTCGCTGCTCTGCAGCTGGAAGCCGGTCGCGGTCTGCGGGAACAGGCGGCTGCCG
CCAGCGGCGAAGACCGGGGCGGTCGGTTGCATCTCGCCCCACTTCAGCATGGTCTTGGAGATGCGCACCTTCACGGCGCC
GCCGGCGCGGCTGTAGTCATCGCGCGGCTTGCCGTCGTTCATCACCGGCAGGTTGCCGGTGCCGGTCTTGTCGGAGGTGC
CGTCGAGCTTCAGGCCCAGGTAGCCGAAGGCATCGACGCCGAAGCCCACAGTGCCTTGGGTGAAGCCGGATTCATAGGTG
GTGAGGAAGCCTTGGGTCCAGTCGACGCGGTCCCCGCTGCCGCTCTTGCCGTCACGGTTGAAATAGTAGTTGCGGAGCAG
CAGGTCGAGGCTGCTGTCTTCGATGAACCCCTTCGCTTCGGCCTGATCGCTGACGAATGCGTCGGCCACGGCGAACTGAG
TGCTACCTGCGGAAACCGCCAGTGCAATGGCGCTCCACTTCATCACTTTCAT