Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

OMPD

Deletion mutants of OmpD display resistance to beta-lactam antibiotics, suggesting that the OmpD porin plays a role in the transport of beta-lactam antibiotics into the bacterial cytosol.

References

  • http://aac.asm.org/content/55/8/3829.full

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Mutant porin proteins

Sequences

Download Sequences

>>MEG_4285|Drugs|betalactams|Mutant_porin_proteins|OMPD
ATGTTTGCTGGTGCAGCAAACGCAGCTGAAATGTACAACAAAGACGGCAACAAAGTAGATATCTACGGTAAAGTTGACGT
TCGTCATTACTTCGCTGATGCTGATACTAAAGGCGATCATGAAAGCGGTGACGCTTCTCGTGCACGTATCGGTTTCAAAG
GCGAAACTCAAATCAATAAAGATTTAACTGGTTTCGGTCGTTTTGAATACGAAGTTAAAACAAACACTACTGAAGGCGAG
AACAAAGCTAAAACTCGTCTAGCATATGCTGGTCTGAAATTTGCTGACTTCGGTTCTTTAGATTACGGTCGTAACTACGG
TGTAATTTATGACACCAACGCATGGACTGACGTTCTGCCTTTATGGGGTGGTGACTCCATGGCGCAAACTGACGTTTATA
TGACTAGCCGTACTACTGGCGTATTAACTTACCGTAACACCGATATGTTCGGTTATGTTGATGGTTTAAGCTTTGCTCTG
CAATATCAAGGCAAAAATAACGAAAACACCAACAATAAACGTAAAGACAACGCTGAAGCAAATGGCGACGGTTTTGGTTT
CTCTACAGCTTATAACTTAGGCTGGGGCGTAACACTGGGTGGCGGTTACTCAAGTTCTGCTCGTACTAACTGGCAAGAAC
ATAAGAGTGATGCTACTGGTAAACGTGCTGAAGCATGGAACGTTGGTGGTAAATTCGAAGCTAACAATGTTTACTTAGCA
GCAATGTACGGTGAAACCCGTAACATGAACTACTATGGTGACGGTGCAATTGCAAACAAAACTCAAAATATCGAGTTAAC
TGCACAGTATGACTTTGCTGATTTAGGTATCAAACCATCTTTAGGTTATGTTCAATCTAAAGGTAAAGATCTGAATAATG
GTGTTGGCGGTCTGAAAGACAACAACCATGATTTAGTTAAATATATCTCTGTAGGTTCTTTCTACAAATTTAACAAAAAC
ATGACTGCAGTTGTTGATTACAAAATCAACCTGTTAGATGAAGATGACTTCACTAAAGCTAACGGCGTTGCAACTGACAA
CGTAGTTGGTTTAGGTCTGACTTATCAGTTCTAA