Warning: "continue" targeting switch is equivalent to "break". Did you mean to use "continue 2"? in /home/meglabuser/megares.meglab.org/vendor/doctrine/orm/lib/Doctrine/ORM/UnitOfWork.php on line 2640
MEGARes
MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

OMP36

The Omp36 porin is similar to OmpC and can harbor mutations resulting in a decreased porin conductance due to narrowing of the lumen. These mutations result in beta-lactam resistance, specifically to cefepime, cefpirome and imipenem. This porin has also been implicated in multi-drug resistance.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2696358/

Deprecated: The behavior of unparenthesized expressions containing both '.' and '+'/'-' will change in PHP 8: '+'/'-' will take a higher precedence in /home/meglabuser/megares.meglab.org/src/Sequence.php on line 169

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Mutant porin proteins

Sequences

Download Sequences

>>MEG_4279|Drugs|betalactams|Mutant_porin_proteins|OMP36|RequiresSNPConfirmation
ATGAAAGTTAAAGTACTGTCCCTCCTGGTACCAGCACTGCTGGTAGCGGGCGCAGCAAATGCGGCTGAAATTTATAACAA
AGACGGCAACAAATTAGACCTGTACGGTAAAATCGACGGTCTGCACTACTTCTCTTCCGACGACAGCGTCGACGGCGACC
AGACCTACATGCGTATCGGCGTGAAAGGCGAAACCCAGATCAACGACCAGCTGACCGGTTACGGCCAGTGGGAATACAAC
GTTCAGGCGAACAACACTGAAAGCTCCAGCGACCAGGCGTGGACTCGTCTGGCCTTCGCGGGTCTGAAATTCGGCGACGC
GGGTTCTTTCGACTACGGTCGTAACTACGGCGTTGTTTACGACGTAACTTCCTGGACCGACGTTCTGCCGGAATTCGATG
GCGACACCTACGGTTCCGACAACTTCCTGCAGTCCCGTGCTAACGGCGTTGCCACCTACCGTAACTCTGACTTCTTCGGT
CTGGTTGACGGCCTGAACTTTGCTCTGCAGTACCAGGGTAAAAACGGCAGCGTGAGCGGCGAAGATCAGACCAACAACGG
TCGCGGCTTCCAGAAACAGAACGGCGAAGGCTTCGGCACCTCCGTGACTTATGAGATCTGGGACGGCATCAGCGCTGGTT
TCGCGTACTCCAGCTCTAAACGTACCGATGAGCAGAACAACTCTACTTATTTTTCTAAGTCCTATCAGCGTACATACGGT
GTTCTGGGTGAAGGCGATCACGCTGAAACCTATACCGGTGGTCTGAAATATGACGCCAACAACATTTACCTGGCGACTCA
GTACACCCAGACCTACAACGCAACTCGCACTGGCGACATCGGTTTTGCTAACAAAGCGCAGAACTTCGAAGTGGTTGCTC
AGTACCAGTTCGACTTCGGTCTGCGTCCGTCCGTGGCTTACCTGCAGTCTAAAGGTAAAGACATGGGCCGTTACGGCGAC
CAGGACATCCTGAAATATGTTGACCTGGGTGCGACCTACTACTTCAACAAAAACATGTCCACCTACGTTGATTACAAAAT
CAACCTGCTGGACGACAACAAGTTCACTAAAGATGCAAGCATCTCTACTGACAACGTTGTGGCTCTGGGCCTGGTTTACC
AGTTCTAA

>>MEG_4280|Drugs|betalactams|Mutant_porin_proteins|OMP36|RequiresSNPConfirmation
ATGAAAGTTAAAGTACTGTCCCTCCTGGTACCAGCACTGCAGGTAGCGGGCGCAGCATATGCGGCTGAAATTTATAACAA
AGACGGCAACAAATTAGACCTGTACGGTAAAATCGACGGTCTGCACTACTTCTCTTCCGACGACAGCGTCGACGGCGACC
AGACCTACATGCGTATCGGCGTGAAAGGCGAAACCCAGATCAACGACCAGCTGACCGGTTACGGCCAGTGGGAATACAAC
GTTCAGGCGAACAACACTGAAAGCTCCAGCGACCAGGCATGGACTCGTCTGGCCTTCGCGGGTCTGAAATTCGGCGACGC
GGGTTCTTTCGACTACGGTCGTAACTACGGCGTTGTTTACGACGTAACTTCCTGGACCGACGTTCTGCCGGAATTCGGTG
GCGACACCTACGGTTCCGACAACTTCCTGCAGTCCCGTGCTAACGGTGTTGCCACCTACCGTAACTCTGACTTCTTCGGT
CTGGTTGACGGCCTGAACTTTGCTCTGCAGTACCAGGGTAAAAACGGCAGCGTAAGCGGCGAAGATCAGACCAACAACGG
TCGCGGCTACCAGAAACAGAACGGCGAAGGCTTCGGCACCTCCGTGACTTATGATATCTGGGACGGCATCAGCGCTGGTT
TCGCGTACTCCAGCTCTAAACGTACCGATGAGCAGAACAGCGTTAACACTCGTTATACTGACTCCAACGGTGTTTCCCGT
CGCGTACTGGGTGAAGGCGATCACGCTGAAACCTACACCGGTGGTCTGAAATACGACGCCAACAACATCTACCTGGCGAC
TCAGTACACCCAGACCTACAACGCAACCCGCACCGGTATCATCGGTTTTGCTAACAAAGCGCAGAACTTCGAAGTAGTTG
CTCAGTACCAGTTCGACTTCGGTCTGCGTCCGTCCGTGGCTTACCTGCAGTCTAAAGGTAAAGACATGGGCCGTTACGGC
GACCAGGACATCCTGAAATATGTTGACCTGGGTGCGACTTACTACTTCAACAAAAACGTGTCCACGTACGTTGATTACAA
AATCAACCTGCTGGACGACAACTGTTTCACTAAAGATGCAAGCATCTCTACTGACAACGTTGTGGCTCTGGGCCTGGTTT
ACCAGTTCTAA

>>MEG_4281|Drugs|betalactams|Mutant_porin_proteins|OMP36|RequiresSNPConfirmation
ATGAAAGTTAAAGTACTGTCCCTCCTGGTACCAGCACTGCTGGTAGCGGGCGCAGCAAATGCGGCTGAAATCTACAACAA
AGACGGCAACAAATTAGACCTGTACGGTAAAATCGACGGTCTGCACTACTTCTCTTCCGACGACAGCGTCGACGGCGACC
AGACCTACATGCGTATCGGCGTGAAAGGCGAAACCCAGATCAACGACCAGCTGACCGGTTACGGCCAGTGGGAATACAAC
GTTCAGGCGAACAACACTGAAAGCTCCAGCGACCAGGCGTGGACTCGTCTGGCCTTCGCGGGTCTGAAATTCGGCGACGC
GGGTTCTTTCGACTACGGTCGTAACTACGGCGTTGTTTACGACGTAACTTCCTGGACCGACGTTCTGCCGGAATTCGGTG
GCGACACCTACGGTTCCGACAACTTCCTGCAGTCCCGTGCTAACGGCGTTGCCACCTACCGTAACTCTGACTTCTTCGGT
CTGGTTGACGGCCTGAACTTTGCTCTGCAGTACCAGGGTAAAAACGGCAGCGTGAGCGGCGAAGATCAGACCAACAACGG
TCGCGGCTTCCAGAAACAGAACGGCGAAGGCTTCGGCACCTCCGTGACTTATGAGATCTGGGACGGCATCAGCGCTGGTT
TCGCGTACTCCAGCTCTAAACGTACCGATGAGCAGAACAACTCTACTTATTTTTCTAAGTCCTATCAGCGTACATACGGT
GTTCTGGGTGAAGGCGATCACGCTGAAACCTATACCGGTGGTCTGAAATATGACGCCAACAACATTTACCTGGCGACTCA
GTACACCCAGACCTACAACGCAACTCGCACTGGCGACATCGGTTTTGCTAACAAAGCGCAGAACTTCGAAGTGGTTGCTC
AGTACCAGTTCGACTTCGGTCTGCGTCCGTCCGTGGCTTACCTGCAGTCTAAAGGTAAAGACATGGGCCGTTACGGCGAC
CAGGACATCCTGAAATATGTTGACCTGGGTGCGACCTACTACTTCAACAAAAACATGTCCACCTACGTTGATTACAAAAT
CAACCTGCTGGACGACAACAAGTTCACTAAAGATGCAAGCATCTCTACTGACAACGTTGTGGCTCTGGGCCTGGTTTACC
AGTTCTAA

>>MEG_4282|Drugs|betalactams|Mutant_porin_proteins|OMP36|RequiresSNPConfirmation
ATGAAAGTTAAAGTACTGTCCCTCCTGGTACCAGCACTGCTGGTAGCGGGCGCAGCAAATGCGGCTGAAATTTATAACAA
AGACGGCAACAAATTAGACCTGTACGGTAAAATCGACGGTCTGCACTACTTCTCTTCCGACGACAGCGTCTACGGCGACC
AGACCTACATGCGTATCGGCGTGAAAGGCGAAACCCAGATCAACGACCAGCTGACCGGTTACGGCCAGTGGGAATACAAC
GTTCAGGCGAACAACACTGAAAGCTCCAGCGACCAGGCGTGGACTCGTCTGGCCTTCGCGGGTCTGAAATTCGGCGACGC
GGGTTCTTTCGACTACGGTCGTAACTACGGCGTTGTTTACGACGTAACTTCCTGGACCGACGTTCTGCCGGAATTCGATG
GCGACACCTACGGTTCCGACAACTTCCTGCAGTCCCGTGCTAACGGTGTTGCCACCTACCGTAACTCTGACTTCTTCGGT
CTGGTTGACGGCCTGAACTTTGCTCTGCAGTACCAGGGTAAAAACGGCAGCGTGAGCGGCGAAGATCAGACCAACAACGG
TCGCGGCTTCCAGAAACAGAACGGCGAAGGCTTCGGCACCTCCGTGACTTATGAGATCTGGGACGGCATCAGCGCTGGTT
TCGCGTACTCCAGCTCTAAACGTACCGATGAGCAGAACAACTCTACTTACTTTTCTAAGTCCTATCGTCGTACATACGGT
GTTCTGGGTGAAGGCGATCACGCTGAAACCTATACCGGTGGTCTGAAATATGACGCCAACAACATTTACCTGGCGACTCA
GTACACCCAGACCTACAACGCAACTCGCACTGGCGACATCGGTTTTGCTAACAAAGCGCAGAACTTCGAAGTGGTTGCTC
AGTACCAGTTCGACTTCGGTCTGCGTCCGTCCGTGGCTTACCTGCAGTCTAAAGGTAAAGACATGGGCCGTTACGGCGAC
CAGGACATCCTGAAATATGTTGACCTGGGTGCGACCTACTACTTCAACAAAAACATGTCCACCTACGTTGATTACAAAAT
CAACCTGCTGGACGACAACAAGTTCACTAAAGATGCAAGCATCTCTACTGACAACGTTGTGGCTCTGGGCCTGGTTTACC
AGTTCTAA