MEGAResFrom MEG, the Microbial Ecology Group

R39

The R39 gene refers to an Ambler class D beta-lactamase found in Actinomadura R39.

References

Other Groups in Class D betalactamases

Sequences

Download Sequences

>CARD|phgb|X53650|320-1235|ARO:3003565|r39|betalactams|Class_D_betalactamases|R39
ATGTTGTTCCCCACGGCCCGCAGGACCGGGTTCGCGGCCCTGGCCGCGCTCGCGCTCGTCCCCGCCGCGGCCTGCTCCGG
CTCCGCCGCGCCCGCCGAGGCGGAGCCGGCGAGCGCGGAGGTGACGGCCGAGGACCTCTCCGGTGAGTTCGAGCGGCTGG
AATCGGAGTTCGACGCCCGTCTCGGGGTCTACGCGGTGGACACCGGGACCGGGGAGGAGGTCTTCCACCGCGCCGACGAG
CGGTTCGGCTACGCCTCCACCCACAAGGCGTTCACGGCGGCCCTGGTCCTGGGGCAGAACACCCCCGAGGAGCTGGAGGA
GGTCGTCACCTACACCGAAGAGGACCTGGTCGACTACTCCCCCATCACCGAGCAGCACGTCGACACGGGGATGACCCTGC
TGGAGGTGGCCGACGCCGCCGTCCGCCACAGCGACAACACCGCCGCGAACCTGCTGTTCGAGGAGCTGGGCGGACCCGAG
GGGTTCGAGGAGGACATGCGGGAGCTCGGCGACGACGTGATCTCGGCGGACCGGATCGAGACCGAGCTCAACGAGGTGCC
GCCCGGCGAGACCCGGGACACGAGCACGCCGCGCGCCATGGCCGGGAGCCTGGAGGCGTTCGTGCTCGGTGACGTCCTGG
AGGAGGGCCCGCGCGACGTGCTCACCGAGATGCTCCTCAACAACACGACCGGTGACGAGCTGATCCGGGCGGGGGTCCCC
GAGGACTGGCGTGTCGGTGACAAGACCGGCGGCGGCAGCCACGGTTCGCGCAACGACATCGCCGTCGTCTGGCCCCCCGA
GGACGACCCCATCGTCATCGCGGTCATGTCCACCCGTGAGCAGGAGGACGCCGAATTCGACAACGCCCTGGTCTCGGGGG
CGACCGAGGTCGTCGTGGAGGCACTGGCCCCGTAG