MEGAResFrom MEG, the Microbial Ecology Group

CEPS

The CepS gene encodes an Ambler class C beta-lactamase.

References

Other Groups in Class C betalactamases

Sequences

Download Sequences

>CARD|phgb|X80277|0-1149|ARO:3003553|CepS|betalactams|Class_C_betalactamases|CEPS
ATGAAACAGACCAGAGCCCTGCCACTGCTGGCCCTCGGCACCCTGCTGCTTGCCCCGCTCTCCCTGGCGGCCCCCGTCGA
TCCGCTGAAGGCGGTGGTGGATGACGCCATCCGCCCCGTGCTCAAGCAGCACAGGATCCCGGGCATGGCGGTCGCCGTGC
TGAAGGGGGGGCAGGCCCACTACTTCAACTACGGGCTGGCCGATGTGGCGACCGGGGCCAAGGTCAATGAGCAGACCCTG
TTCGAGATTGGCTCGGTCAGCAAGACCTATACCGCCACCCTTGGCGCCTACGCCGTGGTCAAGGGGGGCTTCAAGCTCGA
TGACCAGGTGAGCGGGCACGCACCCTGGCTCAAGGGCTCCGCCTTCGATGGCATCACCATGGCGGAACTTGCCACCTACA
GTGCCGGGGGGCTGCCGCTGCAATTCCCCGACGAGGTTGATTCGAGCGATACCATGCGGGCCTATTACCGGCACTGGACG
CCGCCATATCAGGCGGGAACCCAGCGCCAATACTCCAATCCCAGCATCGGCCTGTTCGGCCATCTGGCGGCGAGCAGCCT
GCAGCAGCCGTTTTCCACGTTGATGGAGCAGACCCTGCTGCCAGCACTCGGGTTGGAGCACACCTATCTGCAGGTGCCCG
AGGCCGCCATGGCTCGCTACGCCTTCGGCTACTCGAAGGAGGACAAACCCATCAGGGTCAACCCTGGCATGCTGGCCGAC
GAGGCCTACGGCATCAAGACCGGCTCGGCGGATCTGCTCGCCTTCGTGAAGGCCAATATCAGCGGGGTTGATGACAAGGC
GTTGCAACAGGCGATCGCCCTGACCCACACCGGTTTTTATCGGATAGGGGAGATGAGCCAGGGGCTGGGCTGGGAGAGCT
ACGCCTACCCGGTCAGCGAGCAGACGCTGCTGGCGGGCAACTCCCCGGCGGTGAGCCTCAAGGCCAATCCGGTCACTAAG
TTCGAGACGCCAGCCGCGCCCGGGGCTATGCGCCTCTACAACAAGACCGGGTCGACCGGTGGCTTCGGCGCCTACGTGGC
CTTCGTGCCCGCCAAAGGGATCGGCATCGTCATGCTGGCCAATCGCAATTATCCCATCGAGGCCAGAGTCAGCGCGGCCC
ATGCCATTTTGAGCCAGCTGGCACCCTGA