MEGAResFrom MEG, the Microbial Ecology Group

CEPS

The CepS gene encodes an Ambler class C beta-lactamase.

References

  • http://jac.oxfordjournals.org/content/36/1/41

Other Groups in Class C betalactamases

Sequences

Download Sequences

>>MEG_1654|Drugs|betalactams|Class_C_betalactamases|CEPS
ATGAAACAGACCAGAGCCCTGCCACTGCTGGCCCTCGGCACCCTGCTGCTTGCCCCGCTCTCCCTGGCGGCCCCCGTCGA
TCCGCTGAAGGCGGTGGTGGATGACGCCATCCGCCCCGTGCTCAAGCAGCACAGGATCCCGGGCATGGCGGTCGCCGTGC
TGAAGGGGGGGCAGGCCCACTACTTCAACTACGGGCTGGCCGATGTGGCGACCGGGGCCAAGGTCAATGAGCAGACCCTG
TTCGAGATTGGCTCGGTCAGCAAGACCTATACCGCCACCCTTGGCGCCTACGCCGTGGTCAAGGGGGGCTTCAAGCTCGA
TGACCAGGTGAGCGGGCACGCACCCTGGCTCAAGGGCTCCGCCTTCGATGGCATCACCATGGCGGAACTTGCCACCTACA
GTGCCGGGGGGCTGCCGCTGCAATTCCCCGACGAGGTTGATTCGAGCGATACCATGCGGGCCTATTACCGGCACTGGACG
CCGCCATATCAGGCGGGAACCCAGCGCCAATACTCCAATCCCAGCATCGGCCTGTTCGGCCATCTGGCGGCGAGCAGCCT
GCAGCAGCCGTTTTCCACGTTGATGGAGCAGACCCTGCTGCCAGCACTCGGGTTGGAGCACACCTATCTGCAGGTGCCCG
AGGCCGCCATGGCTCGCTACGCCTTCGGCTACTCGAAGGAGGACAAACCCATCAGGGTCAACCCTGGCATGCTGGCCGAC
GAGGCCTACGGCATCAAGACCGGCTCGGCGGATCTGCTCGCCTTCGTGAAGGCCAATATCAGCGGGGTTGATGACAAGGC
GTTGCAACAGGCGATCGCCCTGACCCACACCGGTTTTTATCGGATAGGGGAGATGAGCCAGGGGCTGGGCTGGGAGAGCT
ACGCCTACCCGGTCAGCGAGCAGACGCTGCTGGCGGGCAACTCCCCGGCGGTGAGCCTCAAGGCCAATCCGGTCACTAAG
TTCGAGACGCCAGCCGCGCCCGGGGCTATGCGCCTCTACAACAAGACCGGGTCGACCGGTGGCTTCGGCGCCTACGTGGC
CTTCGTGCCCGCCAAAGGGATCGGCATCGTCATGCTGGCCAATCGCAATTATCCCATCGAGGCCAGAGTCAGCGCGGCCC
ATGCCATTTTGAGCCAGCTGGCACCCTGA