MEGAResFrom MEG, the Microbial Ecology Group

BLAEC

The BlaEC gene encodes an Ambler class C beta-lactamase.

References

Other Groups in Class C betalactamases

Sequences

Download Sequences

>Bla|AmpC2|Ecoli|CP002970|332756-333889|1134|betalactams|Class_C_betalactamases|BLAEC
ATGTTCAAAACGACGCTCTGCGCCTTATTAATTACCGCCTCTTGCTCCACATTTGCTGCCCCTCAACAAATCAACGATAT
TGTGCATCGCACAATTACCCCGCTTATAGAGCAACAAAAGATCCCGGGTATGGCGGTGGCGGTAATTTATCAGGGTAAAC
CTTATTACTTTACCTGGGGCTATGCGGACATCGCCAAAAAGCAGCCCGTCACACAGCAAACGTTGTTTGAGTTAGGTTCG
GTCAGCAAAACATTTACTGGCGTGCTTGGTGGCGACGCTATTGCTCGAGGGGAAATCAAGTTAAGCGATCCCACAACAAA
ATACTGGCCTGAACTTACCGCTAAACAGTGGAATGGGATCACACTATTACATCTCGCAACCTACACTGCTGGCGGCCTGC
CATTGCAGGTGCCGGATGAGGTGAAATCCTCAAGCGACTTGCTGCGCTTCTATCAAAACTGGCAGCCTGCATGGGCTCCA
GGAACACAACGTCTGTATGCCAACTCCAGTATCGGTTTGTTCGGCGCACTGGCTGTGAAGCCGTCTGGTTTGAGTTTTGA
GCAGGCGATGCAAACTCGTGTCTTCCAGCCACTCAAACTCAACCATACGTGGATTAATGTACCGCCCGCAGAAGAAAAGA
ATTACGCCTGGGGATATCGCGAAGGTAAGGCAGTGCATGTTTCGCCTGGGGCGTTAGATGCTGAAGCTTATGGTGTGAAG
TCGACCATTGAAGATATGGCCCGCTGGGTGCAAAGCAATTTAAAACCCCTTGATATCAATGAGAAAACGCTTCAACAAGG
GATACAACTGGCACAATCTCGCTACTGGCAAACCGGCGATATGTATCAGGGCCTGGGCTGGGAAATGCTGGACTGGCCGG
TAAATCCTGACAGCATCATTAACGGCAGTGACAATAAAATTGCACTGGCAGCACGCCCCGTAAAAGCGATTACGCCCCCA
ACTCCTGCAGTACGCGCATCATGGGTACATAAAACAGGGGCGACCGGCGGATTTGGTAGCTATGTCGCGTTTATTCCAGA
AAAAGAGCTGGGTATCGTGATGCTGGCAAACAAAAACTATCCCAATCCAGCGAGAGTCGACGCCGCCTGGCAGATTCTTA
ACGCTCTACAGTAA