MEGAResFrom MEG, the Microbial Ecology Group

THINB

The THIN-B gene encodes an Ambler class B beta-lactamase.

References

Other Groups in Class B betalactamases

Sequences

Download Sequences

>CARD|phgb|AJ250876|36-987|ARO:3000851|THIN-B|betalactams|Class_B_betalactamases|THINB
ATGACACTATTGGCGAAGTTGATGCTGGCGACGGTTGCGACCATGTCGGCGGCTACGGTGCAGGCAAAGACACCGGCGCC
CAAGCCGGATACCCCTGTCGATTGCGACAGCTGCAAGGCGTGGAACGGGGAAGTCACACCATTCAACGTATTTGGCAATA
CCTGGTATGTGGGCACGGCCGGCTTGTCCGCCGTGCTGGTGACCAGCCCGCAAGGCCACGTCCTGCTCGACGGCGCGCTG
CCGCAATCGGCGCCACTGATCATCGCGAACATCGCGGCGCTGGGTTTCCGCATCGAGGATGTGAAATTCATCCTCAATTC
CCACGCGCATTGGGATCACGCCGGCGGCATCGCCGCGCTGCAGGCCGCCAGCGGCGCCACCGTGGTGGCCAGCGCCTCGG
GCGCCCTGGGATTGCAAAGCGGCACCAACGGCAAGGATGATCCGCAATTCCAGGCCAAGCCTGTCGTGCATGTGGCAAAG
GTGGAGAAGGTCAAGGTGGTGGGCGAGGGCGATGCCATCAAGCTGGGGCCGTTGAACCTGACGGCGCACATGACGCCAGG
CCACACGCCAGGCGCCACCACCTGGACCTGGACCTCGTGCGAAGGGCAGCGCTGCCTGGACGTGGTGTATGCCGACAGCC
TGAATCCGTATTCCAGCGGCGACTTTACGTACACGGGCAAAGGGGACGGACCCGATATCTCGGCCTCGTTTGCCGCCAGC
ATCGCCAAGGTGGCGGCCCTGCCGTGCGACATCATTCTTTCCGTGCATCCCGATTCGACGGGCGTGCTGGACAAGGCGGC
CAAGCGCAGCGGCGAACACAATCCCTTCATCGATGCGAACGCCTGCCGCGCCTATGCGGCCACGGCGGACGCCATGCTGA
CGAAACGGCTGGCGAAGGAGCGCGGCGTGGCCCTGCCTGCGGCGGCCCCGGCTGCCCAGCACGCGCACTAGG