MEGAResFrom MEG, the Microbial Ecology Group

L1

The L1 gene encodes an Ambler class B beta-lactamase.

References

Other Groups in Class B betalactamases

Sequences

Download Sequences

>Bla|L-1|AJ272109|1-888|888|betalactams|Class_B_betalactamases|L1
ATGCGTTCTACCCTGCTCGCCTTCGCCCTCTCGTCGCTCGCCCTGGCCGCCACGCTCTTCACCTTCGACGGCGCCGCCGC
CGACGCATCGCTGCCACAGCTGCAGGCCTACACGGTGGACCCTTCCTGGCTGCAAACGATGGCGCCGTTGCAGATTGCCG
ATCACACCTGGCAGATCGGCACGCATGACCTGACGGCACTGCTGGTCCAGACGGCTGATGGCCTCGTCCTGATCGATGGT
GGCATGCCGCAAATGGCCTCTTACCTGCTGACCAACATGAAGGCCAGGGGAACCAATACCGGTCCCCTGCGCATGGTCCT
GCTCAGCCACGCGCACACCGATCACGCCGGCCCTGTGGCCGAGATCAAGCGCCGCACGGGGGCGCAGGTGGTCGTGAACG
CCGAAACCGCAGTGCTGCTGGCCCGAGGCGGCAGCGACGACCTTCATTTCGGCGACGAAATCACGTTTCCACCGGTCAAT
GCAGACCGCATCGTCATGGATCGGGAGGTCGTCAAGCTGGGCGGCATCGCGTTCACCGCCCATTTCATGCCCGGGCACAC
GCCGGGGAGCACCGCCTGGACCTGGACCGATACGCGCGATGGCAAGCCGGTGCGCATCGCCTATGCCGACAGCCTGAGCG
CGCCGGGCTACCAGCTGCAGGGCAATGCCCGCTATCCCCGCCTGGTTGAGGACTACCGACGCAGCTTCGCTACGGTGCGC
GGCCTGCCCTGCGACCTGTTGCTGACCCCGCATCCGGGCGCCAGCAACTGGAACTATGCTGCTGGCAGCAACGCCAGCGA
GAAGGTACTGAGCTGCAAAGCCTACGCGGATGCGGCCGAGAAGAAGTTCGACGCGCAGCTGGCCAAGGAAACGGCCGGGG
CCCGCTGA

>Bla|blaL1_3_EF126059|betalactams|Class_B_betalactamases|L1
ATGCGCCTTTGCCTGACGACCCTTGCCCTGACTGCCACACTTGCCTTTGATGTGACTGCCGCCGACGCACCGCTGCCGCA
GCTGCAGGCCTACACCGTGGACGCCTCATGGCTGCAGCCGATGGCACCGCTGCAGATTGCCGACCACACCTGGCAGATCG
GCACCGAGGACCTGACCGCGCTGCTGGTGCAGACCGCCGACGGTGCGGTACTGCTCGACGGCGGCATGCCGCAGATGGCC
GGTCACCTGCTGGACAACATGAAGGCACGCGGGGTGGCAGCACAGGATCTACGGCTGATCCTGCTCAGCCATGCGCATGC
CGACCATGCCGGCCCGGTGGCGGAGCTGAAGCGCCGTACCGGCGCCAGCGTAGCGGCCAACGCCGAATCGGCGGTGCTGC
TGGCGCGCGGCGGCAGCAACGACCTGCACTTTGGCGACAGCATCACCTTTCCGCCGGCCAGCGCCGACCGCATCCTCATG
GATGGCGAAGGGGTCACCGTAGGCGGCATCGCGTTCACCGCGCACTTCATGCCGGGGCACACCCCAGGCAGCACCGCCTG
GACCTGGACCGATACCCGCGATGGCCAGCCGGTGCGCATCGCCTACGCCGACAGCCTGAGTGCGCCGGGCTACCAGCTGC
AGGGCAACGCCCGTTATCCACGCCTGGTCGAGGACTACCGGCGCAGCTTCGCTACGGTGCGCGCCCTGCCCTGCGACCTG
CTGCTGACGCCGCATCCGGGCGCCAGCAACTGGAACTATGCCGCGGGTGCAGAGGCCGGAGCCAACGCCCTGACCTGCAA
GGCCTACGCGGATGCGGCCGAGAAGAAGTTCGACGCACAGCTGGCCAGGGAAGCAGCCACGGCACGCTGA