MEGAResFrom MEG, the Microbial Ecology Group

CPHA

The cphA gene encodes an Ambler class B beta-lactamase.

References

Other Groups in Class B betalactamases

Sequences

Download Sequences

>CARD|phgb|NC_000918|1269540-1270521|ARO:3003098|cphA1|betalactams|Class_B_betalactamases|CPHA
TCACTCTCCCATCAGGATTTCGTTTTCTATTTCAAAGTAAACGTAGTAGGCGTTTACAGGGTTCACGTTAAAGAATACAG
GCACCTGAGCGTAAGAGGGATCTATCTTTATCAACTCCTCGTTTATCCTCTCCCTTACGCACTCAACGTCACAACCCTCT
TCGTAGAGTTTCCTTATAGTTTCCCTCAGATCCTTTATGTACTTCCTCGTCCAGCTTACCGCTTCTTTTATCTTTTTCTC
ACCAATTAAAGCTTCCCCGTGTCCCGGAAGGAGTATTCTTGGTTTCATCTTAAGAATTTCGTCAAGACAAACAAGCCAAG
TTCTTGAGTTCCCAGAGCCTAAAAAGGGCAGTCTTCCGTCAAATACTATGTCCCCGCTGAAGAGTACCTTTTCGTCGGGT
ATCCATACGACTATATCTCCGTTCGTGTGAGCCCTGCAAAGGTGCAAGACTTCAAACCTTTTGTACTCCTTTCCCACCTG
AAGGTAGACGTTTAAGTTTTTGGTAAGTGTTATAGTTGGAGGAGTTAATTCCGTTCCTTCCAGATGTTCCTTTAAAATTT
TCTTTCTTGCTAAAAAGAAGTTGTAACTCGAAGGTTGGGATATGTAATCGAATGCCCACTCGTGGGCTATAACTTCAGCT
CCAACTTCTCTGAAAGCTTTTGCACCGTAGAAGTGGTCGGTGTGATAGTGTGTGACGACTAAAAACCTTATGGGTTTATT
CGTAACGCTCCTGATGCTTTCTATTAATTCCTTCCCTAGTTTGTAAGTGCTCAAAGCATCCACAACGAGAACGCCGTCAT
CGGCTACGTAGAAGTAGGCGTTGGATATAAAACCCCTGTTTTCGTAAGATACCTGTTCGTAGACTCCGAAAACTCCGTAA
ATCCTGTCGGTTATCTTCCTTAACGTTTCCTTTACGTGTTTAGGATACTCACTCGAGAAGGAGAATAAAACCAGGAGAAA
AAAGAAGAGAAAGCCCCCCATA

>Bla|cphA6|AY227052|1-765|765|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAAGTTGGATGAAGTGCACATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGCGGCAGCGTGCGGGC
GGCGGGGATCTCCCTCAAGCAGGTAAGCGGCCCGGTGTATGTGGTGGAGGATAACTACTACGTAAAGGAAAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACTGTGGTGGGTGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAGCGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGATCGGGCGGGTGGTAACGCCTACTG
GAAGTCCATTGGCGCCAAGGTGGTCTCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCAGATCTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACCCTG
CAAGAGGGCAAGGTGCGCGCCTTCTATGCGGGCCCGGCCCATACGCCGGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGTAACCTGAGCTTTGCAAATGTGAAGGCCTATCCGCAGACCA
TCGAGCGACTCAAGGCGATGAAGCTGCCGATCAAGACGGTGATCGGCGGTCACGACTCGCCGCTGCACGGCCCCGAGTTG
ATTGATCACTATGAAGAGTTGATCAAGGCCGCTGCTCATTCATAA

>Bla|cphA1_1_AY261379|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTGCGGGCTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGGGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGACGCAGGTGAGCGGCCCTGTGTATGTGGTGGAGGACAACTACTACGTACAGGAAAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACGGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCAGCAAGCCCGTGCTGGAGGTGATCAACAACAACTACCACACCGACCGGGCAGGCGGTAACGCCTACTG
GAAGTCCATCGGTGCCAAGGTGGTATCGACCCGCCAGACCCGGGAGCTGATGAAGAGCGACTGGGCCGAGATCGTCGCCT
TTACCCGCAAGGGGTTGCCGGAGTATCCGGACTTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACCCTG
CAAGAGGGCAAGCTGCGCGCCTTCTACGCGGGCCCGGCCCATACCCCGGACGGCATCTTTGTCTACTTCCCCGATGAGCA
GGTGCTCTATGGCAACTGCATTCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCGGATGTGAAGGCCTATCCGCAGACAC
TTGAGCGGCTGAAAGCGATGAAGCTGCCAATCAAGACGGTGGTGGGTGGTCACGACTCGCCGCTGCACGGCCCTGAGCTG
ATTGATCACTACGAAGCGCTGATCAAGGCGGCAACTCATTCATAA

>Bla|cphA2_6_AHU60294|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATGAAGTGTGGATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGACGCAGGTGAGCGGCCCTGTCTATGTGGTAGAGGACAATTACTACGTGCAGGAAAACTCCATGG
TCTATTTCGGGGCCAAGGGAGTGACTGTTGTAGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGAGTCAGCCGCCAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGGGCGGGCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTATCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTTGCCT
TTACCCGCAAGGGGTTGCCGGAGTACCCGGATCTGCCCCTGGTGCTGCCCAACGTGGTGCACGAGGGCGACTTCACGCTG
CAAGAGGGCAAGCTGCGCGCCTTCTATGCGGGCCCGGCCCACACGCCGGATGGCATCTTTGTCTACTTCCCCGACCAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCGATGTGAAGGCCTATCCGCGCACGC
TTGAGCGGCTCAAGGCGATGAAGCTGCCAATCAAGACGGTGGTGGGCGGTCACGACTCGCCGCTGCATGGGCCTGAGCTT
ATCGATCACTACGAGGCGCTGATCAAGGCCGCACCCCAGTCATAA

>Bla|cphA1_4_AY261376|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTACGGGCTGGCCGGGGCCCTGGTGCTGGTGGCGAGTTTCTGGGGCGGCAGCGTGCATGC
GGCGGCGATCTCCCTCACTCAGGTGAGCGGCCCCGTGTATGTCGTAGAGGATAACTACTACGTCAAAGAGAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACTGTGGTGGGGGCGACCTGGACGCCTGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCAACAAGCCTGTGCTGGAGGTGATCAACACCAACTACCACACGGACAGGGCAGGGGGGAACGCCTACTG
GAAGTCCATCGGTGCCAAGGTGGTATCGACCCGCCAGACCCGGGATCTGATGAAGAGCGATTGGGCCGAGATCGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGACTTGCCGCTGGTGCTGCCGAACGTGGTGCACGACGGCGACTTTACCCTG
CAAGAGGGCAAGGTTCGCGCCTTCTACTTGGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTTCCCGATCAGCA
GGTGCTCTATGGTAACTGCATCCTCAAGGAGACGCTTGGCAACCTGAGCTTTGCCGATGTGAAGGCGTATCCGCAGACGC
TGGAGCGACTCAGGGCGATGAAGCTGCCGATCAAGATTGTGGTTGGCGGTCATGACTCGCCACTGCACGGCCCAGAGCTT
ATCGATCACTACGAAGAGCTGATCAAGGCAAGCCCTCATTCATAA

>Bla|cphA4|AY227050|131-895|765|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATGAAGTGCACATTAGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATCTCCCTTAAGCAGGTGAGTGGCCCTGTGTATGTGGTTGAAGATAACTACTACGTAAAGGAAAACTCCGTGG
TCTATTTCGGGGCCAAGGGGGTGACGGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGATCGGGTGGGCGGTAATGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTGGCGACGCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTATCCGGATCTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACCCTG
CAAGAGGGCAAGGTGCGCGCTTTCTACGCGGGCCCGGCCCATACGCCGGACGGCATCTTTGTCTACTTCCCTGACGAGCA
GGTGCTTTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCAATGTGAAGGCCTATCCGCAGACCA
TCGAGCGGCTTAAAGCGATGAAGTTGCCGATCAAGACGGTGATTGGNGGTCACGACTCGCCGCTGCATGGCCCCGAGCTG
ATTGATCACTACGAGGAGCTGATCAAGGCGGCCGCCGCAGTCTAA

>Bla|CEPH-A3|AY112998|197-961|765|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTGCACATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATCGAGCTCAAGCAGGTGAGTGGCCCTGTCTATGTTGTTGAAGACAACTACTACGTCAAAGAGAACTCCATGG
TCTATTTCGGGGCCAAGGGAGTGACGGTGGTGGGGGCGACCTGGACGCCGGATACTGCTCGCGAGCTGCACAAGCTGATT
AAACGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGGGCGGGCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTGGCGACGCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGATCTGCCGCTGGTGCTGCCAAACGTGGTGCACGATGGCGACTTCACTCTG
CAAGAGGGCAAGGTGCGCGCTTTCTACGCGGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACTTGAGTTTTGCCAATGTGAAGGCGTATCCGCAGACCA
TCGAGCGGCTCAAAGCGATGAAGCTGCCGATCAAGACGGTGATTGGCGGCCACGATTCGCCGCTGCACGGCCCCGAGTTG
ATTGATCACTATGAAGAGCTGATCAAGGCCGTGCCGCAGTCATAA

>Bla|IMIH|AJ548797|924-1688|765|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATGAAGTGTGGATTGGCCGGCGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGACGCAGGTGAGCGGCCCTGTGTATGTGGTAGAGGACAACTACTACGTGCAGGAAAATTCCATGG
TCTATTTCGGGGCCAAGGGCGTGACTGTGGTGGGGGCGACCTGGACGCCGGACACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCCGCCAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGGGCTGGCGGTAACGCCTACTG
GAAGTCCATCGGTGCCAAGGTGGTATCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATCGTTGCCT
TTACCCGCAAGGGGTTGCCGGAGTACCCGGATCTGCCCCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACCCTG
CAAGAGGGCAAGCTGCGCGCCTTCTACGCGGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTCCCCGACCAGCT
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCGATGTGAAGGCCTATCCGCAGACAC
TTGAGCGGCTGAAAGCGATGAAGCTGCCGATCAAGACGGTGGTGGGCGGTCACGACTCGCCACTGCACGGCCCCGAGCTT
ATCGATCACTACGAAGCGCTGATCAAGGCCGCACCCCAGTCATAA

>Bla|cphA8|AY261375|1-765|765|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTGCACATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGATGCAGGTGAGCGGCCCTGTCTATGTTGTTGAAGATAACTACTACGTCAAAGAGAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACGGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCAGCAAACCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGAGCGGGCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTATCGACTCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTATCCGGATCTACCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCAAGCTG
CAAGAGGGCAAGGTGCGCGCCTTCTACGCAGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTCCCCGACCAGCA
GGTGTTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCAATGTGAAGGAGTATCCGCAGACCA
TCGAGCGGCTCAAGGCGATGAAGCTGCCGATCAAGACGGTAATCGGCGGTCACGACTCACCGCTGCACGGGCCTGAGCTG
ATTGATCACTATGAAGAGCTGATCAAGGCGGCAACTCATTCATAA

>Bla|IMIS|Y10415|126-893|768|betalactams|Class_B_betalactamases|CPHA
ATGATGAAGGGTTGGATAAAGTGCGGGCTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTTTGGGGGGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGACGCAGCAGGTGAGCGGCCCTGTTTACGTCGTAGAGGACAACTACTACGTGCAGGAAAATTCCA
TGGTCTATTTCGGGGCCAAGGGAGTGACTGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTG
ATCAAACGGGTCAGCCGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGGGCAGGCGGTAACGCCTA
CTGGAAGTCCATCGGTGCCAAGGTGATATCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCG
CCTTTACCCGCAAGGGGCTGCCGGAGTACCCGGACTTGCCGCTGGTGCTGCCCAACGTGGTGCACGAAGGCGACTTCACG
CTGCAAGAAGGCAAGCTGCGCGCCTTCTACCTGGGCCCGGCTCACAGCCCGGACGGCATCTTTGTTTACTTCCCCGACCA
GCAGGTGCTTTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCGATGTGAAGGCTTATCCGCAGA
CACTTGAGCGGCTGAAAGCGATGAAGCTGCCGATCAAGACGGTGGTGGGCGGTCACGACTCACCGCTGCACGGCCCGGAG
CTTATCGATCACTACGAAGCGCTGATCAAGGCGGCTTCACAATCATAA

>Bla|cphA1_7_X57102|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATGAAGTGTGGATTGGCCGGCGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGACGCAGGTGAGCGGCCCTGTGTATGTGGTAGAGGACAACTACTACGTGCAGGAAAATTCCATGG
TCTATTTCGGGGCCAAGGGCGTGACTGTGGTGGGGGCGACCTGGACGCCGGACACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCCGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGGGCTGGCGGTAACGCCTACTG
GAAGTCCATCGGTGCCAAGGTGGTGTCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTTGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGATCTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACGCTG
CAAGAGGGCAAGGTGCGCGCCTTCTACGCGGGCCCGGCCCATACGCCGGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATTCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCGATGTGAAGGCCTATCCACAGACGC
TTGAGCGGCTGAAAGCGATGAAGCTGCCGATCAAGACGGTGATCGGCGGTCACGACTCACCGCTGCACGGCCCCGAGCTG
ATTGATCACTACGAAGCGCTGATCAAGGCCGCACCCCAGTCATAA

>Bla|cphA1_2_AY261377|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAAGTTGGATGAAGTGTGGATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATCTCCCTTAAGCAGGTGAGCGGCCCTGTTTACGTGGTTGAAGATAACTACTACGTAAAGGAAAACTCCATGA
TCTATTTCGGGGCCAAGGGGGTGACGGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAGCGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGATCGGCGGGCCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTGGCGACGCGCCAGACCAGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGATCTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACCCTG
CAAGAGGGCAAGGTGCGCGCCTTCTACGCGGGCCCGGCCCATACGCCGGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCAATGTGAAGGCCTATCCGCAGACCA
TCGAGCGACTGAAAGCGATGAAGTTGCCGATCAAGACGGTGATCGGCGGTCACGACTCACCGCTGCACGGGCCGAGCTTG
ATTGATCACTATGAAGCGCTGATCAAGGCAAGCCCTCATTCATAA

>Bla|cphA5|AY227051|1-765|765|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTGCGGGCTGGCCGGAGCTGTGGTGCTGGTGGCGAGTTTCTGGGGCGGCAGCGTGCATGC
GGCGGCGATCTCCCTCACTCAGGTAAGCGGCCCTGTCTATGTGGTGGAGGATAACTACTACGTCAAAGAGAACTCCATGG
TTTATTTCGGAGCCAAGGGAGTGACGATAGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAACAACAAGCCTGTGCTGGAGGTGATCAACACCAACTACCACACCGGACAGGCAGGGGGTAACGCCTACTG
GAAGTCCATCGGTGCCAAGGTGGTCTCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATCGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGACTTGCCGCTGGTGCTGCCGAACGTGGTGCACGATGGTGACTTCAATCTG
CAAGAGGGCAAGGTGCGCGCCTTCTATGCGGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTCCCTGACCAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCGATGTGAAGGCGTATCCGCAGACGC
TGGAGCGGCTGAAAGCGATGAAGCTGCCCATCAAGATTGTGGTTGGCGGTCACGACTCGCCGCTGCACGGCCCCGAGTTG
ATTGATCACTACCAGGCGCTGATCAAGGCCGCTACTCACTCATAA

>Bla|cphA|AY261378|1-765|765|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTGCACATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATCTCCCTCAAGCAGGTAAGCGGCCCGGTTTATGTTGTTGAAGATAACTACTACGTAAAGGAAAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACTGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGATCGGGCGGGCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTGGCGACGCGCCAGACCTGGGATCTGATGAAGAGCGATTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTATCCGGATCTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGTGACTTCACGCTG
CAAGAGGGCAAGGTGCGCGCCTTCTTCGCGGGCCCGGCCCACACGCCAGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCAATGTGAAGGCCTATCCGCAGACCA
TCGAACGGCTCAAAGCGATGAAGCTGCCGATCAAGACGGTGGTCGGCGGCCACGACTCCCCGCTGCACGGCCCCGAGCTG
ATTGATCACTACGAAGCGCTGATCAAGGCAAGCCCTCATTCATAA

>Bla|cphA7|AY227053|1-765|765|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATGAAATGCGGATTGGCCGGAGCCGTGGTGCTGATGGCGAGTTTTTGGGGCGGCAGCGTGCGGGC
GGCGGGGATCTCCCTCAAGCAGGTGAGCGGCCCTGTCTATGTGGTGGAGGATAACTACTACGTCAAAGAGAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACTGCGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGTTGCACAAGCTGATC
AAACGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGATCGGGCGGGCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTGGCGACGCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTTGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGATCTGCCGCTGGTGCTGCCGAACGTGGTGCACGATGGCGACTTCAAGCTG
CAAGATGGCAAGGTGCGTGCCTTCTATGCGGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCAATGTGAAGGAGTATCCGCAGACCA
TCGAGCGGCTCAAGGCGATGAAGTTGCCGATCAAGACGGTGATCGGCGGTCACGACTCACCGCTGCACGGCCCCGAGCTG
ATTGATCACTACGAAGCGCTGATCAAGGCCGCTGCTCATTCATAA