MEGAResFrom MEG, the Microbial Ecology Group

CPHA

The cphA gene encodes an Ambler class B beta-lactamase.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/1856163

Other Groups in Class B betalactamases

Sequences

Download Sequences

>>MEG_2098|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTGCACATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATCTCCCTCAAGCAGGTAAGCGGCCCGGTTTATGTTGTTGAAGATAACTACTACGTAAAGGAAAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACTGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGATCGGGCGGGCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTGGCGACGCGCCAGACCTGGGATCTGATGAAGAGCGATTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTATCCGGATCTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGTGACTTCACGCTG
CAAGAGGGCAAGGTGCGCGCCTTCTTCGCGGGCCCGGCCCACACGCCAGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCAATGTGAAGGCCTATCCGCAGACCA
TCGAACGGCTCAAAGCGATGAAGCTGCCGATCAAGACGGTGGTCGGCGGCCACGACTCCCCGCTGCACGGCCCCGAGCTG
ATTGATCACTACGAAGCGCTGATCAAGGCAAGCCCTCATTCATAA

>>MEG_2099|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATGAAATGCGGATTGGCCGGAGCCGTGGTGCTGATGGCGAGTTTTTGGGGCGGCAGCGTGCGGGC
GGCGGGGATCTCCCTCAAGCAGGTGAGCGGCCCTGTCTATGTGGTGGAGGATAACTACTACGTCAAAGAGAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACTGCGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGTTGCACAAGCTGATC
AAACGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGATCGGGCGGGCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTGGCGACGCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTTGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGATCTGCCGCTGGTGCTGCCGAACGTGGTGCACGATGGCGACTTCAAGCTG
CAAGATGGCAAGGTGCGTGCCTTCTATGCGGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCAATGTGAAGGAGTATCCGCAGACCA
TCGAGCGGCTCAAGGCGATGAAGTTGCCGATCAAGACGGTGATCGGCGGTCACGACTCACCGCTGCACGGCCCCGAGCTG
ATTGATCACTACGAAGCGCTGATCAAGGCCGCTGCTCATTCATAA

>>MEG_2100|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATGAAGTGTGGATTGGCCGGCGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGACGCAGGTGAGCGGCCCTGTGTATGTGGTAGAGGACAACTACTACGTGCAGGAAAATTCCATGG
TCTATTTCGGGGCCAAGGGCGTGACTGTGGTGGGGGCGACCTGGACGCCGGACACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCCGCCAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGGGCTGGCGGTAACGCCTACTG
GAAGTCCATCGGTGCCAAGGTGGTATCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATCGTTGCCT
TTACCCGCAAGGGGTTGCCGGAGTACCCGGATCTGCCCCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACCCTG
CAAGAGGGCAAGCTGCGCGCCTTCTACGCGGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTCCCCGACCAGCT
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCGATGTGAAGGCCTATCCGCAGACAC
TTGAGCGGCTGAAAGCGATGAAGCTGCCGATCAAGACGGTGGTGGGCGGTCACGACTCGCCACTGCACGGCCCCGAGCTT
ATCGATCACTACGAAGCGCTGATCAAGGCCGCACCCCAGTCATAA

>>MEG_2101|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTGCACATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATCGAGCTCAAGCAGGTGAGTGGCCCTGTCTATGTTGTTGAAGACAACTACTACGTCAAAGAGAACTCCATGG
TCTATTTCGGGGCCAAGGGAGTGACGGTGGTGGGGGCGACCTGGACGCCGGATACTGCTCGCGAGCTGCACAAGCTGATT
AAACGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGGGCGGGCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTGGCGACGCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGATCTGCCGCTGGTGCTGCCAAACGTGGTGCACGATGGCGACTTCACTCTG
CAAGAGGGCAAGGTGCGCGCTTTCTACGCGGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACTTGAGTTTTGCCAATGTGAAGGCGTATCCGCAGACCA
TCGAGCGGCTCAAAGCGATGAAGCTGCCGATCAAGACGGTGATTGGCGGCCACGATTCGCCGCTGCACGGCCCCGAGTTG
ATTGATCACTATGAAGAGCTGATCAAGGCCGTGCCGCAGTCATAA

>>MEG_2102|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATGAAGTGCACATTAGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATCTCCCTTAAGCAGGTGAGTGGCCCTGTGTATGTGGTTGAAGATAACTACTACGTAAAGGAAAACTCCGTGG
TCTATTTCGGGGCCAAGGGGGTGACGGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGATCGGGTGGGCGGTAATGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTGGCGACGCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTATCCGGATCTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACCCTG
CAAGAGGGCAAGGTGCGCGCTTTCTACGCGGGCCCGGCCCATACGCCGGACGGCATCTTTGTCTACTTCCCTGACGAGCA
GGTGCTTTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCAATGTGAAGGCCTATCCGCAGACCA
TCGAGCGGCTTAAAGCGATGAAGTTGCCGATCAAGACGGTGATTGGNGGTCACGACTCGCCGCTGCATGGCCCCGAGCTG
ATTGATCACTACGAGGAGCTGATCAAGGCGGCCGCCGCAGTCTAA

>>MEG_2103|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTGCGGGCTGGCCGGAGCTGTGGTGCTGGTGGCGAGTTTCTGGGGCGGCAGCGTGCATGC
GGCGGCGATCTCCCTCACTCAGGTAAGCGGCCCTGTCTATGTGGTGGAGGATAACTACTACGTCAAAGAGAACTCCATGG
TTTATTTCGGAGCCAAGGGAGTGACGATAGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAACAACAAGCCTGTGCTGGAGGTGATCAACACCAACTACCACACCGGACAGGCAGGGGGTAACGCCTACTG
GAAGTCCATCGGTGCCAAGGTGGTCTCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATCGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGACTTGCCGCTGGTGCTGCCGAACGTGGTGCACGATGGTGACTTCAATCTG
CAAGAGGGCAAGGTGCGCGCCTTCTATGCGGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTCCCTGACCAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCGATGTGAAGGCGTATCCGCAGACGC
TGGAGCGGCTGAAAGCGATGAAGCTGCCCATCAAGATTGTGGTTGGCGGTCACGACTCGCCGCTGCACGGCCCCGAGTTG
ATTGATCACTACCAGGCGCTGATCAAGGCCGCTACTCACTCATAA

>>MEG_2104|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAAGTTGGATGAAGTGCACATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGCGGCAGCGTGCGGGC
GGCGGGGATCTCCCTCAAGCAGGTAAGCGGCCCGGTGTATGTGGTGGAGGATAACTACTACGTAAAGGAAAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACTGTGGTGGGTGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAGCGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGATCGGGCGGGTGGTAACGCCTACTG
GAAGTCCATTGGCGCCAAGGTGGTCTCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCAGATCTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACCCTG
CAAGAGGGCAAGGTGCGCGCCTTCTATGCGGGCCCGGCCCATACGCCGGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGTAACCTGAGCTTTGCAAATGTGAAGGCCTATCCGCAGACCA
TCGAGCGACTCAAGGCGATGAAGCTGCCGATCAAGACGGTGATCGGCGGTCACGACTCGCCGCTGCACGGCCCCGAGTTG
ATTGATCACTATGAAGAGTTGATCAAGGCCGCTGCTCATTCATAA

>>MEG_2105|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTGCACATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGATGCAGGTGAGCGGCCCTGTCTATGTTGTTGAAGATAACTACTACGTCAAAGAGAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACGGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCAGCAAACCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGAGCGGGCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTATCGACTCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTATCCGGATCTACCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCAAGCTG
CAAGAGGGCAAGGTGCGCGCCTTCTACGCAGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTCCCCGACCAGCA
GGTGTTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCAATGTGAAGGAGTATCCGCAGACCA
TCGAGCGGCTCAAGGCGATGAAGCTGCCGATCAAGACGGTAATCGGCGGTCACGACTCACCGCTGCACGGGCCTGAGCTG
ATTGATCACTATGAAGAGCTGATCAAGGCGGCAACTCATTCATAA

>>MEG_2106|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATGAAGTGTGGATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGACGCAGGTGAGCGGCCCTGTCTATGTGGTAGAGGACAATTACTACGTGCAGGAAAACTCCATGG
TCTATTTCGGGGCCAAGGGAGTGACTGTTGTAGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGAGTCAGCCGCCAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGGGCGGGCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTATCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTTGCCT
TTACCCGCAAGGGGTTGCCGGAGTACCCGGATCTGCCCCTGGTGCTGCCCAACGTGGTGCACGAGGGCGACTTCACGCTG
CAAGAGGGCAAGCTGCGCGCCTTCTATGCGGGCCCGGCCCACACGCCGGATGGCATCTTTGTCTACTTCCCCGACCAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCGATGTGAAGGCCTATCCGCGCACGC
TTGAGCGGCTCAAGGCGATGAAGCTGCCAATCAAGACGGTGGTGGGCGGTCACGACTCGCCGCTGCATGGGCCTGAGCTT
ATCGATCACTACGAGGCGCTGATCAAGGCCGCACCCCAGTCATAA

>>MEG_2107|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATGAAGTGTGGATTGGCCGGCGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGACGCAGGTGAGCGGCCCTGTGTATGTGGTAGAGGACAACTACTACGTGCAGGAAAATTCCATGG
TCTATTTCGGGGCCAAGGGCGTGACTGTGGTGGGGGCGACCTGGACGCCGGACACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCCGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGGGCTGGCGGTAACGCCTACTG
GAAGTCCATCGGTGCCAAGGTGGTGTCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTTGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGATCTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACGCTG
CAAGAGGGCAAGGTGCGCGCCTTCTACGCGGGCCCGGCCCATACGCCGGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATTCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCGATGTGAAGGCCTATCCACAGACGC
TTGAGCGGCTGAAAGCGATGAAGCTGCCGATCAAGACGGTGATCGGCGGTCACGACTCACCGCTGCACGGCCCCGAGCTG
ATTGATCACTACGAAGCGCTGATCAAGGCCGCACCCCAGTCATAA

>>MEG_2108|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAGGGTTGGATAAAGTGCGGGCTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTTTGGGGGGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGACGCAGCAGGTGAGCGGCCCTGTTTACGTCGTAGAGGACAACTACTACGTGCAGGAAAATTCCA
TGGTCTATTTCGGGGCCAAGGGAGTGACTGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTG
ATCAAACGGGTCAGCCGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGACCGGGCAGGCGGTAACGCCTA
CTGGAAGTCCATCGGTGCCAAGGTGATATCGACCCGCCAGACCCGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCG
CCTTTACCCGCAAGGGGCTGCCGGAGTACCCGGACTTGCCGCTGGTGCTGCCCAACGTGGTGCACGAAGGCGACTTCACG
CTGCAAGAAGGCAAGCTGCGCGCCTTCTACCTGGGCCCGGCTCACAGCCCGGACGGCATCTTTGTTTACTTCCCCGACCA
GCAGGTGCTTTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCGATGTGAAGGCTTATCCGCAGA
CACTTGAGCGGCTGAAAGCGATGAAGCTGCCGATCAAGACGGTGGTGGGCGGTCACGACTCACCGCTGCACGGCCCGGAG
CTTATCGATCACTACGAAGCGCTGATCAAGGCGGCTTCACAATCATAA

>>MEG_2109|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTACGGGCTGGCCGGGGCCCTGGTGCTGGTGGCGAGTTTCTGGGGCGGCAGCGTGCATGC
GGCGGCGATCTCCCTCACTCAGGTGAGCGGCCCCGTGTATGTCGTAGAGGATAACTACTACGTCAAAGAGAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACTGTGGTGGGGGCGACCTGGACGCCTGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCAACAAGCCTGTGCTGGAGGTGATCAACACCAACTACCACACGGACAGGGCAGGGGGGAACGCCTACTG
GAAGTCCATCGGTGCCAAGGTGGTATCGACCCGCCAGACCCGGGATCTGATGAAGAGCGATTGGGCCGAGATCGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGACTTGCCGCTGGTGCTGCCGAACGTGGTGCACGACGGCGACTTTACCCTG
CAAGAGGGCAAGGTTCGCGCCTTCTACTTGGGCCCGGCCCACACGCCGGACGGCATCTTTGTCTACTTTCCCGATCAGCA
GGTGCTCTATGGTAACTGCATCCTCAAGGAGACGCTTGGCAACCTGAGCTTTGCCGATGTGAAGGCGTATCCGCAGACGC
TGGAGCGACTCAGGGCGATGAAGCTGCCGATCAAGATTGTGGTTGGCGGTCATGACTCGCCACTGCACGGCCCAGAGCTT
ATCGATCACTACGAAGAGCTGATCAAGGCAAGCCCTCATTCATAA

>>MEG_2110|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAAGTTGGATGAAGTGTGGATTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGTGGCAGCGTGCGGGC
GGCGGGGATCTCCCTTAAGCAGGTGAGCGGCCCTGTTTACGTGGTTGAAGATAACTACTACGTAAAGGAAAACTCCATGA
TCTATTTCGGGGCCAAGGGGGTGACGGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAGCGGGTCAGCAGCAAGCCGGTGCTGGAGGTGATCAACACCAACTACCACACCGATCGGCGGGCCGGTAACGCCTACTG
GAAGTCCATCGGGGCCAAGGTGGTGGCGACGCGCCAGACCAGGGATCTGATGAAGAGCGACTGGGCCGAGATTGTCGCCT
TTACCCGCAAGGGGCTGCCGGAGTACCCGGATCTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACCCTG
CAAGAGGGCAAGGTGCGCGCCTTCTACGCGGGCCCGGCCCATACGCCGGACGGCATCTTTGTCTACTTCCCCGACGAGCA
GGTGCTCTATGGCAACTGCATCCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCCAATGTGAAGGCCTATCCGCAGACCA
TCGAGCGACTGAAAGCGATGAAGTTGCCGATCAAGACGGTGATCGGCGGTCACGACTCACCGCTGCACGGGCCGAGCTTG
ATTGATCACTATGAAGCGCTGATCAAGGCAAGCCCTCATTCATAA

>>MEG_2111|Drugs|betalactams|Class_B_betalactamases|CPHA
ATGATGAAAGGTTGGATAAAGTGCGGGCTGGCCGGGGCCGTGGTGCTGATGGCGAGTTTCTGGGGGGGCAGCGTGCGGGC
GGCGGGGATGTCGCTGACGCAGGTGAGCGGCCCTGTGTATGTGGTGGAGGACAACTACTACGTACAGGAAAACTCCATGG
TCTATTTCGGGGCCAAGGGGGTGACGGTGGTGGGGGCGACCTGGACGCCGGATACCGCCCGCGAGCTGCACAAGCTGATC
AAACGGGTCAGCAGCAAGCCCGTGCTGGAGGTGATCAACAACAACTACCACACCGACCGGGCAGGCGGTAACGCCTACTG
GAAGTCCATCGGTGCCAAGGTGGTATCGACCCGCCAGACCCGGGAGCTGATGAAGAGCGACTGGGCCGAGATCGTCGCCT
TTACCCGCAAGGGGTTGCCGGAGTATCCGGACTTGCCGCTGGTGCTGCCCAACGTGGTGCACGATGGCGACTTCACCCTG
CAAGAGGGCAAGCTGCGCGCCTTCTACGCGGGCCCGGCCCATACCCCGGACGGCATCTTTGTCTACTTCCCCGATGAGCA
GGTGCTCTATGGCAACTGCATTCTCAAGGAGAAGCTGGGCAACCTGAGCTTTGCGGATGTGAAGGCCTATCCGCAGACAC
TTGAGCGGCTGAAAGCGATGAAGCTGCCAATCAAGACGGTGGTGGGTGGTCACGACTCGCCGCTGCACGGCCCTGAGCTG
ATTGATCACTACGAAGCGCTGATCAAGGCGGCAACTCATTCATAA