MEGAResFrom MEG, the Microbial Ecology Group

CFIA

The CfiA gene encodes an Ambler class B beta-lactamase.

References

Other Groups in Class B betalactamases

Sequences

Download Sequences

>Bla|cfiA14|FM200789|162-911|750|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTTTTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
CATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGCATGGTACCTT
CCAACGGGATGATTGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTGACAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGCTATTATTTAGGAGGC
GGGCATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAATATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG

>Bla|cfiA9|AB087234|1-750|750|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACTATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCTAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGTCTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG

>Bla|cfiA8|AB087233|1-750|750|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTTAAAGCCATAG

>Bla|cfiA15|AF429432|1501-2250|750|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
CATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATTGAAGGATGGGGCATGGTACCTT
CCAACGGGATGATTGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCTATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTGACAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCCTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAATATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACTTCAAAGCCATAG

>Bla|cfiA2|AB087226|1-750|750|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATATGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACTTCAAAGCCATAG

>Bla|cfiA4|AB087229|1-750|750|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
CATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGGATGATTGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTGACAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGTCTGGACGGCATGCCTCTCCAATGCTATTATTTAGGAGGC
GGGCATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GACGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGTAACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACTTCAAAGCCATAG

>Bla|cfiA10|AB087227|1-750|750|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCTAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGTCTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATCCCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG

>719|FM200786.1|FM200786|betalactams|Class_B_betalactamases|CFIA
TTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGACATCAGTATCACC
CAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTTCCAACGGGATGAT
TGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAATGCTGGTCAACTGGGTGA
CAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGGACTGGGTTACCTG
CAAAGGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGCCCGTACCGGAACA
TGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGCTATTATTTAGGAGGCGGGCATGCGACCG
ACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCAGGCGACAAGCATC
GGCAACATCTCGGACGCAGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCCCCTCGGCCCGCTA
CGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAACCAATATATAGAAA
GCACCTCAAAGCCATAG

>Bla|cfiA13|FM200787|3-752|750|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
CATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGGATGATTGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAATGCTG
GTCAACTGGGTGACAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAGGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGCTATTATTTAGGAGGC
GGGCATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCAGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG

>Bla|CfiA1|AB087225|1-750|750|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGTCTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACTTCAAAGCCATAG

>Bla|cfiA6|AB087231|1-750|750|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG

>Bla|M63556.1|gene1|betalactams|Class_B_betalactamases|CFIA
TTGTTGCTCAGGCACTTATAAATAATGTTAAACTATAGTGTTGCGGAATTAAGGCATCATATAAAAGAATAAAATGAAAA
CAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGACATCAGT
ATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTTCCAACGG
GATGATTGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAATGCTGGTCAACT
GGGTGACAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGGACTGGGT
TACCTGCAAAGGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGCCCGTACC
GGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGCGGACATG
CGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCAGGCGACA
AGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCCCCTCGGC
CCGTTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAACCAATATA
TAGAAAGCACTTCAAAGCCATAG

>Bla|cfiA3|AB087228|1-750|750|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCTAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGTCTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG