MEGAResFrom MEG, the Microbial Ecology Group

CFIA

The CfiA gene encodes an Ambler class B beta-lactamase.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC171878/

Other Groups in Class B betalactamases

Sequences

Download Sequences

>>MEG_1658|Drugs|betalactams|Class_B_betalactamases|CFIA
atgaaaacagtatttatccttatctccatgcttttccctgtcgcagttatggcacagaaaagcgtaaaaatatccaatga
tatcagtatcacccaactctcggacaaagtgtacacttatgtatccctcgccgaaatcgaaggatggggtatggtacctt
ccaacggaatgattgttatcaacaaccatcaggcagcgttgctggacacaccgatcaatgacgcacaaacggaaacgctg
gtcaactgggtagcggactctttgcatgccaaagtcaccacgtttatcccgaaccactggcacggcgattgtattggcgg
actgggttacctgcaaaagaaaggtgtccaatcatatgcaaaccagatgacgatagacctcgccaaggaaaaagggttgc
ccgtaccggaacatggattcaccgattcactgaccgtcagcttggacggcatgcctctccaatgttattatttaggaggc
ggacatgcgaccgacaatatcgtggtttggctgccgacagagaatatcctttttggcggatgtatgcttaaagacaacca
ggcgacaagcatcggcaacatctcggacgcggacgtgacggcatggccgaaaactctcgataaggtaaaagccaagttcc
cctcggcccgctacgtcgtgcccggacatggcgactatggcggaaccgaactgatagagcataccaagcagatcgtgaac
caatatatagaaagcacctcaaagccatag

>>MEG_1659|Drugs|betalactams|Class_B_betalactamases|CFIA
atgaaaacagtatttatccttatctccatgcttttccctgtcgcagttatggcacagaaaagcgtaaaaatatccgatga
catcagtatcacccaactctcggacaaagtgtacacttatgtatccctcgccgaaatcgaaggatggggtatggtacctt
ccaacgggatgattgttatcaacaaccaccaggcagcgttgctggacacaccgatcaatgacgcacaaacggaaacgctg
gtcaactgggtgacagactctttgcatgccaaagtcaccacgtttatcccgaaccactggcacggcgattgtattggcgg
actgggttacctgcaaaagaaaggtgtccgatcatacgcgaaccagatgacgatagacctcgccaaggaaaaaggattgc
ccgtaccggaacatggattcaccgattcactgaccgtcagcttggacggcatgcctctccaatgctattatttaggaggc
gggcatgcgaccgacaatatcgtggtttggctgccgacagagaatatcctttttggcggatgtatgcttaaagacaacca
gacgacaagcatcggcaacatctcggacgcggacgtgacggcatggccgaaaactctcgataaggtaaaagccaagttcc
cctcggcccgctacgtcgtgcccggacatggtaactatggcggaaccgaactgatagagcataccaagcagatcgtgaac
caatatatagaaagcacttcaaagccatag

>>MEG_1660|Drugs|betalactams|Class_B_betalactamases|CFIA
atgaaaacagtatttatccttatctccatgcttttccctgtcgcagttatggcacagaaaagcgtaaaaatatccgatga
catcagtatcacccaactctcggacaaagtgtacacttatgtatccctcgccgaaatcgaaggatggggtatggtacctt
ccaacgggatgattgttatcaacaaccaccaggcagcgttgctggacacaccgatcaatgacgcacaaacggaaatgctg
gtcaactgggtgacagactctttgcatgccaaagtcaccacgtttatcccgaaccactggcacggcgattgtattggcgg
actgggttacctgcaaaagaaaggtgtccgatcatacgcgaaccagatgacgatagacctcgccaaggaaaaaggattgc
ccgtaccggaacatggattcaccgattcactgaccgtcagcttggacggcatgcctctccaatgctattatttaggaggc
gggcatgcgaccgacaatatcgtggtttggctgccgacagagaatatcctttttggcggatgtatgcttaaagacaacca
ggcgacaagcatcggcaacatctcggacgcagacgtgacggcatggccgaaaactctcgataaggtaaaagccaagttcc
cctcggcccgctacgtcgtgcccggacatggcgactatggcggaaccgaactgatagagcataccaagcagatcgtgaac
caatatatagaaagcacctcaaagccatag

>>MEG_1661|Drugs|betalactams|Class_B_betalactamases|CFIA
atgaaaacagtatttatccttatctccatgcttttccctgtcgcagttatggcacagaaaagcgtaaaaatatccgatga
tatcagtatcacccaactctcggacaaagtgtacacttatgtatccctcgccgaaatcgaaggatggggcatggtacctt
ccaacggaataattgttatcaacaaccatcgggcagcgttgctggacacaccgatcaatgacgcacaaacggaaacgctg
gtcaactgggtgacagactctttgcatgccaaagtcaccacgtttatcccgaaccactggcacggcgattgtattggcgg
actgggttacctgcaaaagaaaggtgtccaatcatacgcaaaccagatgacgatagacctcgccaaggaaaaaggattgc
ccgtaccggaacatggattcaccgattcactgaccgtcagtctggacggcatgcctctccaatgttattatttaggaggc
ggacatgcgaccgacaatatcgtggtttggctgccgacagagaatatcctttttggcggatgtatgcttaaagacaacca
aacgacaagcatcggcaacatctcggacgcggacgtgacggcatggccgaaaactctcgataaggtaaaagccaagttcc
cctcggcccgctacgtcgtgcccggacatggcgactatggcggaaccgaactgatagagcataccaagcagatcgtgaac
caatatatagaaagcacctcaaagccatag

>>MEG_1662|Drugs|betalactams|Class_B_betalactamases|CFIA
atgaaaacagtatttatccttatctccatgcttttccctgtcgcagttatggcacagaaaagcgtaaaaatatccgatga
tatcagtatcacccaactctcggacaaagtgtacacttatgtatccctcgccgaaatcgaaggatggggtatggtacctt
ccaacgggatgattgttatcaacaaccaccaggcagcgttgctggacacaccgatcaatgacgcacaaacggaaatgctg
gtcaactgggtgacagactctttgcatgccaaagtcaccacgtttatcccgaaccactggcacggcgattgtattggagg
actgggttacctgcaaaagaaaggtgtccaatcatacgcgaaccagatgacgatagacctcgccaaggaaaaaggattgc
ccgtaccggaacatggattcaccgattcactgaccgtcagcctggacggcatgcctctccaatgctattatttaggaggc
ggacatgcgaccgacaatatcgtggtttggctgccgacagagaatatcctttttggtggatgtatgcttaaagacaacca
ggcgacaagcatcggcaacatctcggacgcggacgtgacggcatggccgaaaactctcgataaggtaaaagccaagttcc
cctcagcccgctacgtcgtgcccggacatggtaactatggcggaaccgaactgatagagcataccaagcagatcgtgaac
caatatatagaaagcacctcaaaaccatag

>>MEG_1663|Drugs|betalactams|Class_B_betalactamases|CFIA
atgaaaacagtatttatccttatctccatgcttttccctgtcgcagttatggcacagaaaagcgtaaaaatatccgatga
tatcagtatcacccaactctcggacaaagtgtacacttatgtatccctcgccgaaatcgaaggatggggtatggtacctt
ccaacgggatgattgttatcaacaaccaccaggcagcgttgctggacacaccgatcaatgacgcacaaacggaaatgctg
gtcaactgggtgacagactctttgcatgccaaagtcaccacgtttatcccgaaccactggcacggcgattgtattggcgg
actgggttacctgcaaaagaaaggtgtccgatcatacgcgaaccagatgacgatagacctcgccaaggaaaaaggattgc
ccgtaccggaacatggattcaccgattcactgaccgtcagcttggacggcatgcctctccaatgctattatttaggaggc
gggcatgcgaccgacaatatcgtggtttggctgccgacagagaatatcctttttggcggatgtatgcttaaagacaacca
gacgacaagcatcggcaacatctcggacgcggacgtgacggcatggccgaaaactctcgataaggtaaaagccaagttcc
cctcggcccgctacgtcgtgcccggacatggtaactatggcggaaccgaactgatagagcataccaagcagatcgtgaac
caatatatagaaagcacttcaaagccatag

>>MEG_1664|Drugs|betalactams|Class_B_betalactamases|CFIA
atgaaaacagtatttatccttatctccatgcttttccctgtcgcagttatggcacagaaaagcgtaaaaatatctgatga
tatcagtatcacccaactctcggataaagtgtacacttatgtatccctcgccgaaatcgaaggatggggcatggtacctt
ccaacggaataattgttatcaacaaccatcgggcagcgttgctggacacaccaatcaatgacgcacaaacggaaacgctg
gtcaactgggtggcagactctttgcatgccaaagtcaccacgtttatcccgaaccactggcacggcgattgtattggcgg
actgggttacctgcaaaagaaaggtgtccaatcatacgcaaaccagatgacgatagacctcgccaaggaaaaaggattgc
ccgtaccggaacatggattcaccgattcactgaccgtcagtctggacggcacgcctctccaatgttattatttaggaggc
ggacatgcgaccgacaatatcgtggtttggctgccgacagagaatatcctttttggcggatgtatgcttaaagacaacca
aacgacaagcatcggcaacatctcggacgcggacgtgacggcatggccgaaaactctcgataaggtaaaagccaagttcc
cctcggcccgctacgtcgtgcccggacatggcgactatggcggaaccgaactgatagagcataccaagcagatcgtgaac
caatatatagaaagcacctcaaagccatag

>>MEG_1665|Drugs|betalactams|Class_B_betalactamases|CFIA
atgaaaacagtatttatccttatctccatgcttttccctgtcgcagttatggcacagaaaagcgtaaaaatatctgatga
tatcagtatcacccaactctcggataaagtgtacacttatgtatccctcgccgaaatcgaaggatggggcatggtacctt
ccaacggaataattgttatcaacaaccatcgggcagcgttgctggacacaccgatcaatgacgcacaaacggaaacactg
gtcaactgggtgacagactctttgcatgccaaagtcaccacgtttatcccgaaccactggcacggcgattgtattggcgg
actgggttacctgcaaaagaaaggtgtccaatcatacgcaaaccagatgacgatagacttcgctaaggaaaaaggattgc
ccataccggaacatggattcaccgattcactgaccgtcagtctggacggcatgcctctccaatgttattatttaggaggc
ggacatgcgaccgacaatatcgtggtttggctgccgacagagaatatcctttttggcggatgtatgcttaaagacaacca
ggcgacaagcatcggcaacatctcggacgcggacgtgacggcatggccgaaaactctcgataaggtaaaagccaagttcc
cctcggcccgctacgtcgtgcccggacatggcgactatggcggaaccgaactgatagagcataccaagcagatcgtgaac
caatatatagaaagcacttcaaagccatag

>>MEG_1666|Drugs|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGTCTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACTTCAAAGCCATAG

>>MEG_1667|Drugs|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCTAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGTCTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATCCCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG

>>MEG_1668|Drugs|betalactams|Class_B_betalactamases|CFIA
TTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGACATCAGTATCACC
CAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTTCCAACGGGATGAT
TGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAATGCTGGTCAACTGGGTGA
CAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGGACTGGGTTACCTG
CAAAGGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGCCCGTACCGGAACA
TGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGCTATTATTTAGGAGGCGGGCATGCGACCG
ACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCAGGCGACAAGCATC
GGCAACATCTCGGACGCAGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCCCCTCGGCCCGCTA
CGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAACCAATATATAGAAA
GCACCTCAAAGCCATAG

>>MEG_1669|Drugs|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
CATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGGATGATTGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAATGCTG
GTCAACTGGGTGACAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAGGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGCTATTATTTAGGAGGC
GGGCATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCAGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG

>>MEG_1670|Drugs|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTTTTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
CATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGCATGGTACCTT
CCAACGGGATGATTGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTGACAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGCTATTATTTAGGAGGC
GGGCATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAATATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG

>>MEG_1671|Drugs|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
CATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATTGAAGGATGGGGCATGGTACCTT
CCAACGGGATGATTGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCTATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTGACAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCCTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAATATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACTTCAAAGCCATAG

>>MEG_1672|Drugs|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATATGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACTTCAAAGCCATAG

>>MEG_1673|Drugs|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCTAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGTCTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG

>>MEG_1674|Drugs|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
CATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGGATGATTGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTGACAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGTCTGGACGGCATGCCTCTCCAATGCTATTATTTAGGAGGC
GGGCATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GACGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGTAACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACTTCAAAGCCATAG

>>MEG_1675|Drugs|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG

>>MEG_1676|Drugs|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACCATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTTAAAGCCATAG

>>MEG_1677|Drugs|betalactams|Class_B_betalactamases|CFIA
ATGAAAACAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGA
TATCAGTATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTT
CCAACGGAATGATTGTTATCAACAACTATCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAACGCTG
GTCAACTGGGTAGCGGACTCTTTGCATGCTAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGG
ACTGGGTTACCTGCAAAAGAAAGGTGTCCAATCATACGCAAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGATTGC
CCGTACCGGAACATGGATTCACCGATTCACTGACCGTCAGTCTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGC
GGACATGCGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCA
GGCGACAAGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCC
CCTCGGCCCGCTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAAC
CAATATATAGAAAGCACCTCAAAGCCATAG

>>MEG_1678|Drugs|betalactams|Class_B_betalactamases|CFIA
TTGTTGCTCAGGCACTTATAAATAATGTTAAACTATAGTGTTGCGGAATTAAGGCATCATATAAAAGAATAAAATGAAAA
CAGTATTTATCCTTATCTCCATGCTTTTCCCTGTCGCAGTTATGGCACAGAAAAGCGTAAAAATATCCGATGACATCAGT
ATCACCCAACTCTCGGACAAAGTGTACACTTATGTATCCCTCGCCGAAATCGAAGGATGGGGTATGGTACCTTCCAACGG
GATGATTGTTATCAACAACCACCAGGCAGCGTTGCTGGACACACCGATCAATGACGCACAAACGGAAATGCTGGTCAACT
GGGTGACAGACTCTTTGCATGCCAAAGTCACCACGTTTATCCCGAACCACTGGCACGGCGATTGTATTGGCGGACTGGGT
TACCTGCAAAGGAAAGGTGTCCAATCATACGCGAACCAGATGACGATAGACCTCGCCAAGGAAAAAGGGTTGCCCGTACC
GGAACATGGATTCACCGATTCACTGACCGTCAGCTTGGACGGCATGCCTCTCCAATGTTATTATTTAGGAGGCGGACATG
CGACCGACAATATCGTGGTTTGGCTGCCGACAGAGAATATCCTTTTTGGCGGATGTATGCTTAAAGACAACCAGGCGACA
AGCATCGGCAACATCTCGGACGCGGACGTGACGGCATGGCCGAAAACTCTCGATAAGGTAAAAGCCAAGTTCCCCTCGGC
CCGTTACGTCGTGCCCGGACATGGCGACTATGGCGGAACCGAACTGATAGAGCATACCAAGCAGATCGTGAACCAATATA
TAGAAAGCACTTCAAAGCCATAG