MEGAResFrom MEG, the Microbial Ecology Group

BCII

The BCII gene encodes an Ambler class B beta-lactamase.

References

Other Groups in Class B betalactamases

Sequences

Download Sequences

>CARD|phgb|M19530|415-1186|ARO:3002878|BcII|betalactams|Class_B_betalactamases|BCII
ATGAAAAATACATTATTAAAATTAGGGGTATGTGTTAGTTTACTAGGAATAACTCCATTTGTTAGTACAATTTCTTCTGT
ACAAGCAGAACGAACGGTAGAGCATAAAGTAATAAAAAATGAGACAGGAACTATTTCGATTTCTCAGTTAAACAAAAATG
TATGGGTTCATACGGAGTTAGGTTATTTTAGCGGAGAAGCAGTTCCTTCGAACGGTTTAGTCCTTAATACTTCTAAAGGG
TTAGTACTTGTCGATTCTTCTTGGGATGATAAGTTAACGAAGGAATTAATAGAGATGGTAGAAAAGAAATTTAAGAAGCG
CGTAACAGATGTCATTATTACACATGCACACGCTGATCGAATTGGTGGAATGAAAACATTGAAAGAAAGGGGCATTAAAG
CGCATAGTACAGCGTTAACTGCGGAATTAGCAAAGAAAAATGGATATGAAGAACCACTTGGAGACTTACAAAGCGTTACA
AATTTGAAGTTTGGAAATATGAAAGTAGAAACATTTTATCCAGGGAAGGGACATACAGAAGATAATATTGTTGTTTGGTT
GCCACAATATCAAATTTTAGCTGGAGGCTGTTTAGTTAAATCTGCGTCCTCTAAAGATTTAGGAAACGTTGCTGATGCGT
ATGTAAATGAATGGTCCACATCGATTGAAAATGTGCTGAAGCGATATGGAAATATAAATTTAGTAGTGCCTGGTCATGGA
GAAGTAGGGGATAGAGGATTACTTTTACATACATTGGATTTGTTGAAATAAA