MEGAResFrom MEG, the Microbial Ecology Group

PENA

The penA gene encodes an Ambler class A beta-lactamase.

References

Other Groups in Class A betalactamases

Sequences

Download Sequences

>475|unknown_id|unknown_name|betalactams|Class_A_betalactamases|PENA
ATGAATCCTCCAATCCATCGCCGCACCCTGTTGCTCGCCGCCTCGGTCCTCCCGCTCGCAAGCGCCTGCACCGCGTGGTC
CGCCAAGGGGCCGCAGCAAGACGCATCGGCGCAGCTCGCCGCGCTCGAAGCCGCATCGGGCAGCCGGCTCGGTGTGGTCG
GTTTCAACACCGCCACCGGCGCGCGCGTGCAGCACCGTGCCGAGGAACGCTTTCCGTTCTGCAGCACCTTCAAGCTCATG
CTGGCCGCGGCCGTCCTCGAACGCAGCGCGAAAGAGGGCGACCTGCTCGCGCGCCGCGTCAACTACAGCAAGGGCGACCT
GGTCTCCTACTCGCCCATCACCGAAAAGAATGTGGCGACCGGCATGACGGTGGCCGAGCTGTGCGCCGCCACCGTCCAGT
ACAGCGACAACGGCGCGGCCAACCTGCTGATGAAGATCCTGGGCGGCCCGTCCGCCGTGACGGCCTTTGCGCGTGCCTCC
GGCGACGAGGTCTTCAGGCTGGACCGCTGGGAGACCGAACTCAACACCGCCATCCCCGGCGACCTGCGCGACACCACCAC
GCCCGCGGCCATGGCGGCAAGCGTGCAGCGGCTGGTGCTGGGCAACGCGCTGGGCGCGGCACAGCGCGAGCAGCTCAAGA
CCTGGTTGCTGGGCAACACCACGAGCACCCAGCGCTTCCTGGCCGGCGTGCCCGCCGGCTGGAAGGTGGGCGACAAGACC
GGTTCGGGCTCCTACGGCACCACGAACGACGTGGGCGTGCTGTGGCCGCCGGCCGGCGCGCCGCTGGTGCTGGCGGTCTA
CCTGACGTTTCCGCAGAAGGAGGCGAAGGGGCGCAGCGATGTGGTTGCGTCGGCGACGCGCATTGCGGTGAGCGCGCTGG
CGAGCTGA