MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

NMCA

The nmcA gene is a carbapenem-hydrolyzing class A beta-lactamase.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/7793864

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Class A betalactamases

Sequences

Download Sequences

>>MEG_4201|Drugs|betalactams|Class_A_betalactamases|NMCA
ATGCGTGCCAGATTACCTTTAAATGCATTACGAGCTTTTGAAGCCTCAGCAAGATATCTAAATTTTACTAAAGCCGGACT
AGAACTTCATGTAAGCCAGGCCGCCGTAAGCCAGCAGGTCAGAACACTTGAACAAATGCTTGGTGTGGCTCTTTTTACAA
GAGTACCGCGTGGGTTACAGTTGACAGACGAAGGCATGCATCTTTTGCCTTCGATTACAGAAGCTTTGCAGATGATGAGT
TCTGCGATGGATAAATTCCATGAAGGTAAGATTAAAGAGGTGCTTACTATTGCTGTCGTAGGGACTTTTGCAATAGGATG
GCTCCTTCCTCGGATTACTGCGTTTCTTAATGAAAATCCATGGATTGATATTAGAATTTTAACGCATAATAACGTTGTCA
ATCTTGCTGCAGAAGGTATTGATGCATCTATTAGATTTGGAACAGGCGGCTGGATTAATACGGAAAATATTTTACTCTTT
CAGGCGCCGCATACAGTATTGTGTTCCCCGGAAACATCCAAGAAATTGTACATTCCATCAGACTTAAAAAAAGTTTGCTT
ACTGCGTTCCTATCGAAAGGAGGAATGGAATAATTGGTTTAAAGCTGCTGGGATCGACCCTTGGACTATTACAGGGCCTA
TCTTTGATTCTACCAGACTTATGATAGATGCTGTAAAGTTAGGTGATTATGCAGCACTAGTTCCTTATCATATGTTTCAA
AAAGAATTAAATGAGCGATCCGTGGCAAAACCTTTTGAAATTTATGCCACGCTTGGCGGTTATTGGCTTACTTTGCAGAA
ATCTCGGGTTAATCATAATAGTGAAGCACTTAATGTTTTCAAGGAATGGATTATCGAGCATAGCAGAGAGTTTGTATTAA
AATCCTAG

>>MEG_4202|Drugs|betalactams|Class_A_betalactamases|NMCA
ATGTCACTTAATGTAAAGCAAAGTAGAATAGCCATCTTGTTTAGCTCTTGTTTAATTTCAATATCATTTTTCTCACAGGC
CAATACGAAGGGCATTGATGAGATTAAAAACCTTGAAACAGATTTCAATGGCAGGATTGGTGTCTACGCTTTAGACACTG
GCTCGGGTAAATCATTTTCGTACAGAGCAAATGAACGATTTCCATTATGTAGTTCTTTTAAAGGTTTTTTAGCTGCTGCT
GTATTAAAAGGCTCTCAAGATAATCGACTTAATCTTAATCAGATTGTGAATTATAATACAAGAAGTTTAGAGTTCCATTC
ACCCATCACAACTAAATATAAAGATAATGGAATGTCATTAGGTGATATGGCTGCTGCTGCTTTACAATATAGCGACAATG
GTGCTACTAATATTATTCTTGAACGTTATATCGGTGGTCCAGAGGGTATGACTAAATTCATGCGGTCGATTGGAGATGAA
GATTTTAGACTCGATCGTTGGGAGTTAGATCTAAACACAGCTATTCCAGGCGATGAGCGTGACACATCTACACCTGCAGC
AGTAGCCAAGAGTCTGAAAACCCTTGCTCTGGGTAACATACTTAGTGAACATGAAAAGGAAACCTATCAGACATGGTTAA
AGGGTAACACAACCGGTGCAGCGCGTATTCGTGCTAGCGTACCAAGCGATTGGGTAGTTGGCGATAAAACTGGTAGTTGC
GGAGCATACGGTACGGCAAATGATTATGCGGTAGTCTGGCCAAAGAACCGGGCTCCTCTTATAATTTCTGTATACACAAC
AAAAAACGAAAAAGAAGCCAAGCATGAGGATAAAGTAATCGCAGAAGCTTCAAGAATTGCAATTGATAACCTTAAATAA