MEGAResFrom MEG, the Microbial Ecology Group

NMCA

The nmcA gene is a carbapenem-hydrolyzing class A beta-lactamase.

References

Other Groups in Class A betalactamases

Sequences

Download Sequences

>Bla|NMC-A|Z21956|1221-2099|879|betalactams|Class_A_betalactamases|NMCA
ATGTCACTTAATGTAAAGCAAAGTAGAATAGCCATCTTGTTTAGCTCTTGTTTAATTTCAATATCATTTTTCTCACAGGC
CAATACGAAGGGCATTGATGAGATTAAAAACCTTGAAACAGATTTCAATGGCAGGATTGGTGTCTACGCTTTAGACACTG
GCTCGGGTAAATCATTTTCGTACAGAGCAAATGAACGATTTCCATTATGTAGTTCTTTTAAAGGTTTTTTAGCTGCTGCT
GTATTAAAAGGCTCTCAAGATAATCGACTTAATCTTAATCAGATTGTGAATTATAATACAAGAAGTTTAGAGTTCCATTC
ACCCATCACAACTAAATATAAAGATAATGGAATGTCATTAGGTGATATGGCTGCTGCTGCTTTACAATATAGCGACAATG
GTGCTACTAATATTATTCTTGAACGTTATATCGGTGGTCCAGAGGGTATGACTAAATTCATGCGGTCGATTGGAGATGAA
GATTTTAGACTCGATCGTTGGGAGTTAGATCTAAACACAGCTATTCCAGGCGATGAGCGTGACACATCTACACCTGCAGC
AGTAGCCAAGAGTCTGAAAACCCTTGCTCTGGGTAACATACTTAGTGAACATGAAAAGGAAACCTATCAGACATGGTTAA
AGGGTAACACAACCGGTGCAGCGCGTATTCGTGCTAGCGTACCAAGCGATTGGGTAGTTGGCGATAAAACTGGTAGTTGC
GGAGCATACGGTACGGCAAATGATTATGCGGTAGTCTGGCCAAAGAACCGGGCTCCTCTTATAATTTCTGTATACACAAC
AAAAAACGAAAAAGAAGCCAAGCATGAGGATAAAGTAATCGCAGAAGCTTCAAGAATTGCAATTGATAACCTTAAATAA