MEGAResFrom MEG, the Microbial Ecology Group

CBLA

The cblA gene encodes an Ambler class A beta-lactamase.

References

Other Groups in Class A betalactamases

Sequences

Download Sequences

>CARD|phgb|GQ343019|132-1023|ARO:3002999|CblA-1|betalactams|Class_A_betalactamases|CBLA
ATGAAAGCATATTTCATCGCCATACTTACCTTATTCACTTGTATAGCTACCGTCGTCCGGGCGCAGCAAATGTCTGAACT
TGAAAACCGGATTGACAGTCTGCTCAATGGCAAGAAAGCCACCGTTGGTATAGCCGTATGGACAGACAAAGGAGACATGC
TCCGGTATAACGACCATGTACACTTCCCCTTGCTCAGTGTATTCAAATTCCATGTGGCACTGGCCGTACTGGACAAGATG
GATAAGCAAAGCATCAGTCTGGACAGCATTGTTTCCATAAAGGCATCCCAAATGCCGCCCAATACCTACAGCCCCCTGCG
GAAGAAGTTTCCCGACCAGGATTTCACGATTACGCTTAGGGAACTGATGCAATACAGCATTTCCCAAAGCGACAACAATG
CCTGCGACATCTTGATAGAATATGCAGGAGGCATCAAACATATCAACGACTATATCCACCGGTTGAGTATCGACTCCTTC
AACCTCTCGGAAACAGAAGACGGCATGCACTCCAGCTTCGAGGCTGTATACCGCAACTGGAGTACTCCTTCCGCTATGGT
CCGACTACTGAGAACGGCTGATGAAAAAGAGTTGTTCTCCAACAAGGAGCTGAAAGACTTCTTGTGGCAGACCATGATAG
ATACTGAAACCGGTGCCAACAAACTGAAAGGTATGTTGCCAGCCAAAACCGTGGTAGGACACAAGACCGGCTCTTCCGAC
CGCAATGCCGACGGTATGAAAACTGCAGATAATGATGCCGGCCTCGTTATCCTTCCCGACGGCCGGAAATACTACATTGC
CGCCTTCGTCATGGACTCATACGAGACGGATGAGGACAATGCGAACATCATCGCCCGCATATCACGCATGGTATATGATG
CGATGAGATGAG