MEGAResFrom MEG, the Microbial Ecology Group

BLAA

The blaA gene encodes an Ambler class A beta-lactamase.

References

Other Groups in Class A betalactamases

Sequences

Download Sequences

>Bla|A_1_DQ424965|betalactams|Class_A_betalactamases|BLAA
TTATTAGCTGGTATTACCCTGCCCTTAGTTAATTTTTCGCTACCTACCTGGGCTGCTGGGATCCCGGGATCATTAGACAA
GCAATTGGCAGCACTTGAGCACAGTGCTAACGGTCGTTTAGGCATTGCGATGATTAATACCGGCAATGGCACCAAAATTC
TGTATCGCGGAGCTCGACGTTTCCCATTCTGTAGTACTTTTAAGTTTATGTTAGCCGCTGCTGTATTGGGTCAAAGCCAA
TCTCAGCCGAATTTGCTCAATAAGCATATCAATTACCATGAGAGTGATTTGTTATCTTATGCCCCCATCACGCGTAAAAA
TCTGGCGCATGGTATGACAGTTTCTGAATTATGTGCGGCTACCATTCAATATAGCGATAACACGGCCGCGAATTTATTAC
TTAAAGAGTTGGGTGGTTTAGCGGCTGTTAATCAGTTTGCTCGCAGTATTGGCGATCAGATGTTCAGGTTAGACCGCTGG
GAACCGGATTTAAACACCGCATTACCTAATGACCCACGTGATACCACCACTCCTGCGGCTATGGCAGCTAGTATAAATAA
ATTGGTATTGGGTGATGCATTGCACCCTGCCCAACGAAGCCAACTCACGGCATGGCTGAAAGGAAACACCACCGGGGATG
CCACGATTCGCGCGGGTGCCCCTACTGACTGGATTGTGGGTGACAAAACAGGTAGTGGCGATTACGGAACCACCAATGAT
ATTGCGGTACTTTGGCCGACGAAAGGTGCACCGATTGTTTTAGTGGTGTATTTCACGCAACGTGAAAAAGATGCAAACCC
CGTTCCCGATGTATTGGCCCTTTGCCAACCAAAATATTTTGGCCGCAAATTTTGA

>Bla|A2|NC_010410|2507740-2509014|1275|betalactams|Class_A_betalactamases|BLAA
ATGAATCTGAATATAAGAGGACATTTAATGAAGAACTTTCTCACCAAGAAAATGTACGCAACTAGAGCTTTATTTTTTGC
TGTAGGTGTTACGGCTTTGAATGTTTCCCCTATTGTTATTTCTACTACTCATGCAGCGACAGAACAAAAAATGGATAATT
TATCGACTACACTTTCATTAATTTTTGCAGATAAACCCATAGAAGCTTCTTTATTTAGCCCTCAATTTTTAGGACAAGTT
CCCATCACACAAATTCAAAAAATCGTTGATGATTTAAAAGTCTCTTTAGGTGCTCTTAAAAATATTAATGTTTCAAATGG
CTCTGGGACTATTGATTTCGAAAAGGGAGAATTACCCGTTTCAATTAGCTTAAATGAGCAAGAACAAATTAGTACTCTTT
GGTTTAGTGCGCCTCATTTTAAGACAATAAGCCTAGACGAAATGGTTAAAGGTCTACATGAAAATGCGATCGGTAAAACT
TCTCTTTTAGTTATTGTAGATAACAAGCCTGTGGTTGTAGAAAATGATAAAACCCCTATGGCTGTCGGTTCGACTTTTAA
GTTACTAGTTTTAAAAGCTTATGAAGATGCGATAAAAAAAGGCGAATTAAAAAGAGAAACTATTGTTTCTTTAAAAGAAA
AGAATCGCTCGTTGCCAACAGGAGTTTTACAAAACTTGCCTGCTGGTACACCTATAAATCTCGAACTTCTTGCGCAGTTA
ATGATACAAATTAGCGATAATACAGCAACAGATAGCTTGATAGATGTATTAAAGAAACCTCGTATAGAAGCGTTGTCACC
TAGAAATTCTCCTCTGCTGACGACACGAGAGCTATTTCAACTGATTGATTCAAGTAATGAAAAGCTCAGAAATAAGTTTA
AAACAGGAACAAAGTCGGCTCGTCTGGAAGCACTCTCTGAGCTAGACAAACTGCCACTACCAAGTGTGAGTAGCATTGGA
AAATCGGCTACTTGGCAAGATGCTGAATGGTATATGTCAGCCCATGAGATTTGTCCTCTTCTTGAAAGTGTTCAAGATGC
TCCGGCTCTGAACAGTTCTTTAAATCCACTTTTTAAAAATTTAAATTGGCAAAAGATTGGTTTCAAAGGTGGTTCCGAAT
ACGGCGTCATCAACTTTTCTGTAATTGGAAAAACTCAAAAAGGTCATAACGTGTGTGCCGTATTTACCGCAAATGGAAAT
GAGCCACAACCCGAATCAAAACTAGCAATATTATTTACAGGCATACTTCAAGCTGTTGATTCTATGAGTCATTAG

>Bla|A_2_AY954728|betalactams|Class_A_betalactamases|BLAA
ATGAAGCACTCTTCGCTACGGCGTGCGCTATTATTAGCCGGTATTACCCTGCCCTTAGTCAATTTTTCGCTGCCAACCTG
GGCCGCTGCGATTCCGGGGTCATTAGACAAGCAATTGGCAGCACTTGAGCACAGTGCTAACGGTCGTTTAGGCATTGCGA
TGATTAATACCGGCAATGGCACCAAAATTCTGTATCGCGGAGCTCGACGTTTCCCATTCTGTAGTACTTTTAAGTTTATG
TTAGCCGCTGCTGTATTGGGTCAAAGCCAATCTCAGCCGAATTTGCTCAATAAGCATATCAATTACCATGAGAGTGATTT
GTTATCTTATGCCCCCATCACGCGTAAAAATCTGGCGCATGGTATGACAGTTTCTGAATTATGTGCGGCTACCATTCAAT
ATAGCGATAACACGGCCGCGAATTTATTACTTAAAGAGTTGGGTGGTTTAGCGGCTGTTAATCAGTTTGCTCGCAGTATT
GGCGATCAGATGTTCAGGTTAGACCGCTGGGAACCGGATTTAAACACCGCACTACCTAATGACCCACGTGATACCACCAC
TCCTGCGGCTATGGCAGCTAGTATAAATAAATTGGTATTGGGTGATGCATTGCACCCTGCCCAACGAAGCCAACTCACGG
CATGGCTGAAAGGAAACACCACCGGGGATGCCACGATTCGCGCGGGTGCCCCTACTGACTGGATTGTGGGTGACAAAACA
GGTAGTGGCGATTACGGAACCACCAATGATATTGCGGTACTTTGGCCGACGAAAGGTGCACCGATTGTTTTAGTGGTGTA
TTTCACGCAACGTGAAAAAGATGCGAAGCCACGTCGCGATGTATTGGCCTCTGCGACCAAAATAATTTTGTCGCAAATAT
CCTGA

>Bla|BlaA1|NC_010410|1803480-1804499|1020|betalactams|Class_A_betalactamases|BLAA
ATGACTATTTCAAACACAACAGACTTGCCTGCTCCCTTAATGCCATCACAGCAACACAATGGCAAATTTAGAAATACGCG
TCCGAACCAACACAAGCCTTCTTTTGGCAAAACGCTTCAACTCATGTGGAAGTTTCTATTTAACAAACCTAAAAATACCG
TTCCAAACAGAGAAATTCCTGTTTTAAGTTTGTCAAAAGAACAGCTTTTAAGTGCGCCTGACCGTTCTCTATTTCGTTTG
GGTCACTCAACTATCCTGTTAAAACTGCAAGATGAATTTTGGTTAACTGACCCTGTTTTTTCAGAGCGTGCATCACCTTT
TCAATGGCTTGGACCAAAACGTTTCCATCAGCCCCCAATTAGTATTGCCGAATTACCACCCATTAAAGGCGTGATTTTGT
CGCATAACCACTACGACCACCTCGATTACCATGCGGTCATGCAGCTTAACGATAAAGTTGAGCACTTCTTAACACCGCTT
GGTGTGGGTGATACACTCATTAAATGGGGAATTCCAGCAGAAAAGGTTCAGCAGCTCGACTGGTGGGGTACCACACAGGT
AGATGGACTAAAATTAGTTGCTACCCCTGCCCATCATTTTTCAGGCCGTGGTATGGGTGATAGCAATGCGACACTTTGGG
CATCGTGGGTGATTATTGATAATGATTTACGTGTATTTTTTAGTGGAGATACGGGCTATTTTGACGGGTTTAAAGAAATC
GGTCTTCGTTATGGACCTTTCGATCTGACCATGTTAGAAACGGGTGCTTACGACCCCGAATGGCCTGATGTTCACATGCA
ACCAGAGCAAACTTTACAAGCTCATATCGATTTAAAAGGACGTCATTTGTTGCCTGTGCACAACGGTACTTTTGACTTGG
CACTTCATGCTTGGGACGACCCTTTTGAACGTATCGTCGCTTTGGCTCAACAAAATAATTTAGCGATTAGCACACCGCAA
ATGGGACAAATTTTGAACTTAAACGAGCCGAATGTTGAAAATTATTGGTGGCGTTCGTGA

>Bla|A|CP003048|1-885|885|betalactams|Class_A_betalactamases|BLAA
ATGAAAAAAATAATTACGCTGATAATTGGTATAATATTTATAACTTTTAGTTTTGCTACTACAAAAATAGATACCCAAGT
TACCAATGATATTCAAAATATAGAAAAAAAACATGGTGGTAAAATTGGTGTATATACTATAAATCGAAATGACTGGAGTA
ATTTTGCAGTCAATGCTAGCTTCTACTTTCCAATATGTAGTACTTATAAATTTCTTGTAGTTGGTGCAATACTTAAACAA
AGTATGACTGATAATAAACTACTTAATCAAAAAATCAAAATCTCAAAAAATCAAATTGTTGAGTATTCCCCTATTACAAG
AAGGCATATTAATCAAATAATGACTGTGAAACAACTTTGCCAAGCATCTATGCAAGGGGATAATACTGCGACAAATATCC
TAATTGAAAAACTAGGTGGTTTGAAAAATCTCAATAAGTTTATCTTATCGCTTGCAGATCATGCGACAAAAGTCGCTAAT
TTAGAGCCTAAAGTCAATCATGTCAGCCTAACGACAAACGAAAATAAGACCACTCCCAAGATTATGGCAAGAGATATTAA
TAAACTTGCTTTTAGCGATGATATACTTGATAAAAAACATCGCTTAATGTTTAAACAATGGCTAATAGCGAGTAATACTA
GCAACAATCGTATAGCTGCTGAGGTGCCTGATGAGTGGGAAGTTGGTGATAAAACTGGAACTTGTCAATATGGTACAACA
AATGATGTTGCTATTATTTGGCCTGATGATAATAGAGCTGTTATTATGGCAATTTTTTATACCCAATCGCAAAAAAATGC
TAAACCAAACAGTAAAATTGTTAGAGAGGTAACTAAAATACTGCTAAACAGACTACAATTAAACAATACTACGAAAAATG
CCTAA