MEGAResFrom MEG, the Microbial Ecology Group

TMRB

The tmrB gene encodes a membrane bound enzyme that binds ATP, however the direct mechanism of action that causes resistane to tunicamycin is not currently known.

References

Sequences

Download Sequences

>CARD|phgb|AL009126|339155-339749|ARO:3003059|tmrB|Tunicamycin|ATP-binding_tunicamycin_resistance|TMRB
TTATTTGATGCGGATATGATTCAGCTTTACCATTAATCTGTCGGCGAACCTTCGGAGGCTGCCTCTTGTATCAGGATCTA
ATGGGAGTTCGGCTCTCGCGGCAATGTTCTCTGCCACATCCTGAATCGACAGGTTGTCTGTTTGAATGTGGTCCTCAAAA
ATGGGTGATGATAATCCTTCAACACAGCGGTCAATTTGTTTGGCGGCCCATGAGTTTTTTCCTTCTGCTCTGGTGCGCAG
CCTTTTTAACAAGGTTTCCTTTGAAGCCATTAGTGTAAAGTGGTGAACGATCCTGCCTTCCTGTCTGAGCCTGCCGATGA
TCTCATTGAAGTATTCAGGGTGTACAATCGTCATAGGCACAATAAGGATGCCGCGGTATGTATCTGTCAGAGAAGCTAGC
AAACTGTAATTGAACGCCCGCCATAAAGGATAGCTTTGAAAATCGTCCTTTGCGATCTCCTGCGGCACCATGGAGCGCAG
CGCAAAACCCATTTTCTCGGGATCATACACGTAAGATGGGTTCAGCCTTCTGTGCAGTTCGAAGGCTGTTTGTGTTTTTC
CCGAACCGAATGCCCCGTTTATCCAAATGATCATC