MEGAResFrom MEG, the Microbial Ecology Group

TSNR

The tsnR gene encodes a thiostrepton resistance factor that interacts with the ribosome to reduce the effect of thiostrepton.

References

Sequences

Download Sequences

>CARD|phgb|AL123456|1853605-1854388|ARO:3003060|tsnr|Thiostrepton|Thiostrepton_23S_rRNA_methyltransferases|TSNR
GTGCTCACCGAACGCTCGGCCAGGGTGGCCACGGCGGTCAAACTGCATCGTCACGTAGGCCGGCGCCGGGCGGGACGTTT
TCTCGCCGAAGGCCCCAACCTGGTAGCGGCGGCGTTGGCGCGCGGGCTGGTACGGGAGGTATTCGTCACCGAAGTTGCGG
CGCGGCGGCACGAGCTCTTGTTGGCCGCGCACGAGGCTTCGGTTCATCTGGTGACTGAGCGGGCCGCGAAGGCGCTCTCT
GATACGGTCACGCCGGCCGGGTTGGTGGCGGTGTGCGATCTGCCGGCGACCCGACTTGAGGATGTATTGGCCGGCTCACC
TCAGCTGATCGCGGTGACCGTCGAGATCCGCGAGCCGGGCAACGCGGGCACGGTAATCCGCATCGCCGACGCCATGGGTG
CCGCGGCGGTGATCCTCGCCGGGCGCAGCGTCGACCCATACAACGGCAAGTGTCTGCGCGCGTCCACCGGTAGCATCTTC
GCGATCCCGGTCGTCGTCGCGCCCGATGTCGGTGCCGCCATCGCCGACCTGCGAGCGGCCGGACTGCAGGTGCTGGCCAC
CGCAGTGGACGGCGAGATGGCTCTCGACGATGCCGATCGGCTGCTTGCCGAGCCGACGGCATGGCTGTTCGGGCCCGAAG
CACACGGGTTGTCGGCCGAGATCGCGGCCTTGGCGGACCACCGCGTACACATCCTGATGTCGGGAGGGGCGGAGAGCCTC
AACGTCGCGGCCGCGGCCGCGATCTGTCTGTATGAGAGCGCTCGGGCGTTGGGCCGCCGCTGAT