MEGAResFrom MEG, the Microbial Ecology Group

TSNR

The tsnR gene encodes a thiostrepton resistance factor that interacts with the ribosome to reduce the effect of thiostrepton.

References

  • http://www.ncbi.nlm.nih.gov/pubmed/7590303

Other Groups in Thiostrepton 23S rRNA methyltransferases

Sequences

Download Sequences

>>MEG_7285|Drugs|Thiopeptides|Thiostrepton_23S_rRNA_methyltransferases|TSNR
GTGGCCAATCTTGACGTTATTGTCGACCGTTCCGACCCCGCGGTGCAGCGCATCGTCGATGTGACCAAGCATTCCCGGTC
CGTCGTGCGAACGGTGCTGATCGAGGACATCGAGCCCCTGACGCAGAGCATCCGCGCCGGGGTCGAGTTCACCGAGGTCT
ACGGTCTCGACACCGTGCCGTTCCCGGGTGATCTGCTCGCCGCCTGCGAAAAGCGCGGAATTCGGGTGCGGCTGCTCTCC
GCCGCGGTCGCGAATCAGGTTTTCAAGACCGAGAAGAAGCCCAAGGTCTTCGGTATCGCGAAGGTTCCGCCGGCCGGCCG
TTTCGCCGACCTGGAGAGCCTTTCCGGCGATGTCGTCCTGCTCGACGGCGTGAAGATCGTCGGCAACATCGGCGCCATCG
TGCGGACGCGTTCGGCGCTCGGCGCCGCCGGCATCGTCCTGGTCGACAGCGGCCTCGGCACCATCGCGGACCGCCGGCTC
ATCCGCGCCAGCCGCGGCTACGTGTTCTCCCTGCCGATCGTGCTCGCGACGCGCGACGAGGCGCTGGCCTTCTTCCGTGA
CGGCGGGATGCGGCCCGTGGTCTTCGAGGCGGACGGCAAGCTGTCCATCGGAGAGCTCGACGGCATCGACGAGCGGCTCG
TGCTCGTGTTCGGCAGCGAGAAGACCGGCCCGTCGGGCGAGTTCGCCGGGGTCGCCACCGAGTCGGTGTCCATCCCGATG
AACCCCGCCGCCGAGTCGCTCAACGTCTCGGTGTCGGCCGGCATCGCCCTGCACCGGCGGGCCCGCCGCAACCTCTCGCG
CCCGCGCGGCTGA