MEGAResFrom MEG, the Microbial Ecology Group

TETR

Resistance to tetracycline is regulated by the tetR gene in gram-negative bacteria, and this gene has been shown to regulate multi-drug efflux as well. A protein family of this same name is also a transcriptional regulator class.

References

Sequences

Download Sequences

>248|unknown_id|unknown_name|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGAGTAAAAAAGATATTGCACCTCAACGTCTGACACGTGAAATAGTCCTGCGTACCGCATTGGATATGTTGAATGAAGA
AGGCATAGATTCAATAACCACACGCAAGCTAGCTCAACGATTGGGTATTAAATCTCCAACTCTATATTGGCATTTCAAGA
ATAAATCCTTGTTAATGGAAGCAATGGCGGAAACCATTATAAATGAACACCATTTAGTTTCTTTACCCATCGATGGGATG
ACATGGCAAGATTGGTTGCTCGCTAATTCTGTAAGCTTTCGTCGAGCACTACTAGCTTACCGTGATGGTGCTCGTCTACA
TGCAAGAACTAGCCCCAGTCAAGGACATTTCAACACGATTGAGGCCCAAGTTGCGCTGTTATCTCATGCTGGGTTTTCTC
CTGTTGAAGCAGTTGCATTACTTATGACATTAGGAAGGTTTATTGTTGGGTGGGTCCTTGAGGAGCAGCAAGAAGAAATA
AGATCAGACCCACCATTCGAAGCCGATCCAACTATATATCCACTCATGCTCCAAGGAGTGAATACCTTACAAAATATGAA
TGCGGATGACATTTTTGAAAATGGGATTCGTATGGTGATTATCGGTGCTGAAAGACAACTTGATATTAAAATGCAAACTT
AA

>Tet|TetR|HF545434|53576-54226|651|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGACAAAGTTGCAGCCGAATACAGTGATCCGTGCCGCCCTGGACCTGTTGAACGAGGTCGGCGTAGACGGTCTGACGAC
ACGCAAACTGGCGGAACGGTTGGGGGTTCAGCAGCCGGCGCTTTACTGGCACTTCAGGAACAAGCGGGCGCTGCTCGACG
CACTGGCCGAAGCCATGCTGGCGGAGAATCATACGCATTCGGTGCCGAGAGCCGACGACGACTGGCGCTCATTTCTGATC
GGGAATGCCCGCAGCTTCAGGCAGGCGCTGCTCGCCTACCGCGATGGCGCGCGCATCCATGCCGGCACGCGACCGGGCGC
ACCGCAGATGGAAACGGCCGACGCGCAGCTTCGCTTCCTCTGCGAGGCGGGTTTTTCGGCCGGGGACGCCGTCAATGCGC
TGATGACAATCAGCTACTTCACTGTTGGGGCCGTGCTTGAGGAGCAGGCCGGCGACAGCGATGCCGGCGAGCGCGGCGGC
ACCGTTGAACAGGCTCCGCTCTCGCCGCTGTTGCGGGCCGCGATAGACGCCTTCGACGAAGCCGGTCCGGACGCAGCGTT
CGAGCAGGGACTCGCGGTGATTGTCGATGGATTGGCGAAAAGGAGGCTCGTTGTCAGGAACGTTGAAGGACCGAGAAAGG
GTGACGATTGA

>83|JQ768046.1|JQ768046|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
TTGGGATACAGTCCTGTATTCGGGAAGCGCATCAAGGAGGCGGTCACCATCACGAAGCGACTCACCCGGCAGCAGAGCCG
GCAGGTCACCCGCGAGCAGATCCTCCGGTCGGCGGCCGCCCTCTTCGCGGGCCAGGGCGTCAGCGGAACCTCGGTGGAGC
AGATCGTCGAGTCCGCCGGATACACCCGCGGCGCCTTCTACGGCAACTTCGAGGGCAAGCACGAGCTCGTCCTCGCCCTG
CTGGAGCAGCGGACCCAGCACGAGCTCGAAGAGATCCAGGCGATGAGCCGCGAGGCGGCCACCTTCGAGGAGATGCTGGA
CCACCTGCGCTCCTGGCACCGACGGCGCGACGAGAACCTCGCCAGCTGGCTCGCGCTGCGCACCGAACTCTGGCTCTACG
GACTGCGCGACCCGGAGCTGCTGCCCCTGTTGGCGGACCGCGAGCGCCGCTCGCGGGACGCGATCGCCCAGTCGCTGGAG
CAGGGCTTCGCCGCACGCGGGGTGACCACCCCGGCGCCCGTGGAGCTCCTGGCACTGATCGTCCACGCGCTGGACGACGG
ACTGTCCATCCAGCGCGTGCTCTTCCCCTCCGACAGCGGCACGGACTCCGTCGTGGACGTGGTGGAGCTCCTCATGAAGT
CCTGGACCGCACTCGCCCGCAGCACCGCACCCGCACCCGCGGCCGAACCCGCCGCCGAACCCCCGACCGAGAAGCTGGAG
AAGAACCCATGA

>825|S52438.1|S52438|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGACCAAACTGGACAAGGGCACCGTGATCGCGGCGGGCCTAGAGCTGTTGAACGAGGTTGGCATGGACAGCCTGACGAC
GCGGAAGCTCGCTGAACGCCTCAAGGTTCAGCAGCCTGCGCTTTACTGGCATTTCCAGAACAAACGAGCGCTGCTTGATG
CGCTGCCCGAGGCGATGCTGCGGGAACGCCATACCCGCTCGCTACCCGAAGAGAATGAGGACTGGCGGGTGTTCCTGAAA
GAGAATGCCCTGAGCTTCAGAACGGCGTTGCTCTCTTATCGGGACGGCGCGCGTATCCATGCCGGCACTCGACCGACAGA
ACCGAATTTTGGCACCGCCGAGACGCAAATACGCTTTCTCTGCGCGGAGGGCTTTTGTCCGAAGCGCGCCGTTTGGGCGC
TCCGGGCGGTCAGTCACTATGTGGTCGGTTCCGTTCTCGAGCAGCAGGCATCTGATGCCGATGAGAGAGTTCCGGACAGG
CCAGATGTGTCCGAGCAAGCACCGTCGTCCTTCCTGCACGTACTGTTTCACGAGTTGGAAACAGACGGCATGGATGCTGC
GTTCAACTTCGGACTCGACAGCCTCATCGCTGGTTTCGAGCGGCTGCGTGCTGCAGTGCTAGCGACAGATTGA

>200|unknown_id|unknown_name|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGACGAACCCCGCACCTCTCGGTCGCCGCGAACGGAAGAAGGCCGCGACCCGCAAGGCGATCTCCGACGTCGCGACGGC
CATGTTCCTGGAACGCGGCTTCGATGAGGTGAGCATCCGCGAGGTCGCCGATGCCGCAGATGTCTCCCCCACGACCGTGT
TCGCGCACTTCCCTCAGAAGGAGGCGCTGGTGTTCGACGAAGACGACGAGCAGCGCGACCGCCTGGTGGCCGCCGTCCGC
GAGCGCCCGTCGGGGAGCACGATCAACCGCGCCATCCACGACTTCTACGCCTCAGAGCTCCGCGCGAACGTCGACGAGCA
CGGAGACGAGATCACTCGCACCTTCATGCGCTTCCTGAACGAGACACCGGCGCTGCGCGACTACGCGGCGAAGATGTGGC
TCCGACACGAAGACGCCCTCTCCGACGCGATCGCCGACGAACTGGGACTCGATACACCCACCCCGGAGATCCGGGTCTAC
TCGCGGTTCATCCTGCAGATGCAGCTGCTCGTCAACGAGAACGACGACCCCTTCGGGACGCTCGAAGCAGGGTTCGTGAT
CCTCGAGAACGGCTGGGCGCCGGTCGAAGCCGGCCTCAGCGGATCCGCCAGCTAG

>697|unknown_id|unknown_name|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
GTGGTCGGCGTGGGGCTGAGGGAGCGCAAGAAACTGGACACCCGGCGGGCGCTGAGTGACGCCGCGCTGAGGCTGATGTT
CGAGCGCGGCCTGGAGAACGTCACGCGCGAAGACATCGCCAACCTGGCGGGCGTCTCCTTGCGCACGTTCACCAACTACT
TCAACGGCAAGTACGACGCATTGGCGTACCGCCAGGTCGAACGCATGCGGCGCAGCATCGAGACGCTGCGCAATCGTCCG
GTCGGTGAGCCGTTGTGGACGTCGGTCATTGAGGCCGTGTTGGAGCCGCTCGACGAGGACTTCGAGGACATGTATGGAGC
GGAGAACGTCCTGCCCACTCGCCAGCAGCTCGCCGAGGTCCGAAAACTGTTGATGGTGCCGGAGATCCGCGATGCGACGT
TCCGTGCGATGTTCGACGAATGGGTTGCGGTCATCGCCGAACGTACCGGCACCGATCCCGCACATGACATGTATCCACGA
CTCGTGGTGGCCGTCGTCCGCGCGGTGGGCGACGTCGCGATGGACCAGTACGCGAACGCCGATCCACCGGTGTCCTTCAC
CGAACTACTGCGTCAGGGGTTCGCGGCCGTCACCGCGGGACTGCCTGAACCCGAGAGGAAGAAATGA

>285|AF121000.1|AF121000|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGACTCACCACCGGAAGCGTCTCGACCGCACGTCCGTGTTGCTCGGGGCCCGGCAGGTGCTCGACGAGACTGGGCTCGA
TGGCTTCACCACTCGCGCGCTGGCGGCTCACTTACAGGTACAGCAGCCCGGCCTCTACTGGCACTTCCGCACGAAGGCCG
AACTCCTCGCAGCGCTGGCGAGCGACGTGCTTGACCGAGAGCATCACGCTTCCTTCCCCGAGTCCGACGAGAAATGGGAC
GCATTTCTCTTGCGAAACGCAAGAAGTTTCCGCCACGCACTACACGCGGTCCGTGACGGTGCGCGTCTCCACGCTGAGCA
CCACCGCAGACCATCCGGCGACGACACCGACGAAGGAGCTGAGGCTTCCGGTCAGCAAGTCGGGCTTCTCGTGTCTCAGG
GATTCGATGAACAGACAGCCATCAGCATGCTCATCGCGGTCAGCCGATACACCGTCGGTGTCGTACTGGAGGAGCAAACC
GCAGAGGTCGGCAATGCGAGCGTTCCTGAACGCGACCGGGAATTCGATTTCGGCCTGACAGCACTGATCGACGGATTCTC
TCACTCCCGCACAGCGTCATTGACCTCGAGCGAATCGTGA

>143|unknown_id|unknown_name|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGGCAAAGCTAGATAAAGAACAAGTTATTGATAATGCGTTGATTTTACTTAATGAAGTTGGTATTGAAGGATTAACAAC
GCGTAAGCTGGCGCAAAAAATAGGTGTGGAACAACCCACATTGTATTGGCATGTAAAAAATAAACGCGCTTTGTTAGATG
CATTAGCAGAAACTATTTTGCAAAAGCACCATCATCATGTTTTGCCATTGCCGAATGAAACATGGCAGGACTTTTTGCGA
AATAACGCGAAAAGCTTCCGCCAAGCCTTATTAATGTATCGTGATGGTGGCAAAATTCATGCGGGAACACGCCCCTCTGA
AAGTCAATTTGAGACATCAGAACAGCAACTACAGTTTTTGTGTGATGCTGGGTTTAGTCTATCTCAAGCCGTGTATGCAT
TAAGCTCTATTGCGCATTTTACATTAGGCTCCGTACTGGAAACTCAAGAGCATCAAGAAAGCCAAAAAGAGCGTGAAAAA
GTAGAGACGGATACTGTTGCCTATCCGCCATTATTAACCCAAGCCGTTGCAATTATGGATAGTGATAATGGTGATGCTGC
ATTTTTGTTTGTCCTTGATGTGATGATCTCTGGACTTGAAACAGTATTAAAGAGCGCTAAATAA

>CARD|pvgb|AL513383|179218-179845|ARO:3003479|tetR|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGATGTCTAGATTAGATAAAAGTAAAGTGATTAACAGCGCATTAGAGCTGCTTAATGAGGTCGGAATCGAAGGTTTAAC
AACCCGTAAACTCGCCCAGAAGCTAGGTGTAGAGCAGCCTACATTGTATTGGCATGTAAAAAATAAGCGGGCTTTGCTCG
ACGCCTTAGCCATTGAGATGTTAGATAGGCACCATACTCACTTTTGCCCTTTAGAAGGGGAAAGCTGGCAAGATTTTTTA
CGTAATAACGCTAAAAGTTTTAGATGTGCTTTACTAAGTCATCGCGATGGAGCAAAAGTACATTTAGGTACACGGCCTAC
AGAAAAACAGTATGAAACTCTCGAAAATCAATTAGCCTTTTTATGCCAACAAGGTTTTTCACTAGAGAATGCATTATATG
CACTCAGCGCTGTGGGGCATTTTACTTTAGGTTGCGTATTGGAAGATCAAGAGCATCAAGTCGCTAAAGAAGAAAGGGAA
ACACCTACTACTGATAGTATGCCGCCATTATTACGACAAGCTATCGAATTATTTGATCACCAAGGTGCAGAGCCAGCCTT
CTTATTCGGCCTTGAATTGATCATATGCGGATTAGAAAAACAACTTAAATGTGAAAGTGGGTCTTAAA

>474|unknown_id|unknown_name|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGCCCAAGGTGCTCTCTGATGAAGACGTCGGTGAATTCCGTCAACGGCTCCTGAAAACCGCGGAAGCCGCGTTCGCCAC
GCACGGCGTCGACGGGGTTTCGATGCGCCAGCTCGCGCAGCAACTGGGGTGCAGCGCGACAACCCCTTATCGCTATTTCA
AGAACAAGGACGAGATCCTCGCGGCGGTCACGGCCGCGGCCTTGAACCGGTTCTCCGCAACGCTCGAAAAGGCGTTCGCC
GCCAAGGGCAGCAGCGCCGAGAAGGCGGTCGCGGTGCGCAAGGCCTACATCCGCTTCGCCTTCAAGAACCCCAAGGCCTA
TAGGCTGATGTTCGATGCGCCGCATCCGAGCCTGCTGGACTACGCCGATCTTTCAGAAGCCTCCAGCCGCGCGGACCGGA
TCATGGCCGCGCCCCTGGCTCTTCTGGCGCAAGAGGGCATCGTCAAGGGCGACTCCCGGCTCCTGGGGCGCGTGTTCTGG
AGCGCGATCCACGGCGCGGTTTCGCTGCAACTGGCCGGCAAGCTCGCGGCGAAACCCACATTCGAAGCCGTTCTCGAACA
GACATTGCAGCTGATCATGGCCGGCGCCATGGCGACCCGTCATTCCGCTTGA

>253|unknown_id|unknown_name|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGGCTATCGGACGTGATCGCATTGTCGATGAGGCCCTGCGGCTCCTGAACGAGGTGGGAATAGACAAGCTGTCCACCCG
CAAGCTCGCGGAACGGCTGGGCGTCCAGCAGCCGGCGCTCTACTGGCACTTCCGCAACAAGGCGGAATTGCTCGACGCCA
TCAATTCCGAAATGCTGCTGCGTTATCACTGCGATCGCCTGCCCAAACCCGGCCAGGATTGGATTACGTTCACGCTGGCC
AATGCCCGCAGCATTCGCAAGACCTTGCTCACCGTGCGCGATGGCGCGCGGCTAACCGCAGGTACACGGCCTTCCGTCGC
CGAGTTTGCCGATGTGGAAAGCGTCTTGCAGCTCTATGTCGAGACGGGATTTTCCGCAGAGGAGGCATTTGGGATCGCCA
TTTGCATCACGCGCTATGTGGTCGGCTATGTGCTCGAAGAACAGGGAGAGCGCGAACGGGATCGGATGGATCAACACTCG
CCCAATACCGACATCATGGCAGAACTCGCACAGTTCCCCCTGCTTGCAAAAGCTCTTGAAAGCTTCCCCACGGTTGGAAC
GGTCAACACCGAAGCCGTGTTCGAGAGTGGGCTAAGTTACCTGCTGGCCGGTATGAAGGAGAAGCTGCGGGAGAAACAGT
CTAGATAG

>261|AY264780.2|AY264780|Tetracyclines|Tetracycline_transcriptional_repressor|TETR|RequiresSNPConfirmation
ATGAGCGAAAAAAATACTGCGGCGCGTTTAACGCGTGAAACGGTCCTGCGCGGGGCGCTGGCGTTACTGGATGACATCGG
CATCGATGCCCTGAGCACCCGCCGCCTGGCGCAGCATCTGGGCGTGCAATCCCCCACGCTCTATTGGCACTTCAAAAACA
AGGCCGAGCTGCTGAAGGCGATGGCGGAAACCATCATGTTGGACCACCGCGAAGAGGTGCCCGCCGACATGCCCTGGCAG
GCCTGGGTGACCGCCAATGCGATCAATTTCCGCCGCGCGTTGCTGGCTTACCGCGACGGGGCGCGCCTGCACGCCGGCAC
CCGGCCGCAGGAACCGCAATTCGCCATCATCGAGGCCAAGGTGGCGCTGCTGTGCCGGGCGGGCTTTACGCCGGAACACG
CCGTTAATCTGCTGTTCGCCGTCGGGCGTTTTGTGGTGGGTTGGGTGCTGGAAGAGCAGCAAATGCAGCCCGATGATGCG
CTGAACGAAGCCGATCGCCGGCGCTACCCGCTGCTGTGTGGAGGCTGGGAAAAGCTGCAGGACAAGGGGGCAGACGCGTT
GTTCGAAGCCGGCCTCCGGCTGTTGGTTGACGGCGCCGAGGCCGCGTTGACGAACGCCAATAATCACGGCGCGCAATCAT
AA