MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TETW

The tetW gene encodes a tetracycline ribosomal protection protein.

References

  • http://aac.asm.org/content/47/12/3675

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>>MEG_7206|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgcgaaagatggcgtgcaggc
ccagacccgtattctgctccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgatgcattattgga
aaagtatatcgcaggagaaccaatcagccaggaaaaacttgcgcgggaggaacagcggcgggttcaagaagcctccctgt
ttccggtctatcatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacaggactgttccaaccg
attggggaacaagggggcgccgccctatgcggcagcgttttcaaggttgagtacaccgattgcggccagcggcgtgtcta
tctgcggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggcgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggatcaaacccggctccctcgtaaaaggtggcgcgaggcccccctccccatgctgcg
gacgacgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgctgcgaagtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggtcgtttcc
gctttgctgtcggaaaaatacaagattgaaacagtggtaaaggaacccaccgtcatttatacggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatctatcggactgtctgttacaccactcccgc
ttggctccggcgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccagtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcggggacgc
agctgctggaaccttatctctccttcaccctctatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
ggaatacaggaacgatttaacttatttcacaaatgagcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7207|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgcgaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgatgcattattgga
aaagtatatcgcaggagaaccaatcagccaggaaaaacttgcgcgggaggaacagcggcgggttcaagaagcctccctgt
ttccggtctatcatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacaggactgttccaaccg
attggggaacaggggagcgccaccctatgcggcagcgttttcaaggttgagtacaccgattgcggccagcggcgtgtcta
tctgcggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggcgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggatcaaacccggctccctcgtaaaaggtggcgcgaggcccccctccccatgctgcg
gacgacgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgctgcgaagtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggtcgtttcc
gctttgctgtcggaaaaatacaagattgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatctatcggactgtctgttacaccactcccgc
ttggctccggcgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccagtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcggggacgc
agctgctggaaccttatctctccttcaccctctatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaacttatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7208|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcactg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgataaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgtgcgggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgccgccctatgcggcagcgttttcaaggtggagtatacagattgcggccagcggcgtgtcta
tctacggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggagaaattgttattttagctgatgatact
ttgaaactgaacgacattctaggaaatgaaaaactcctgcctcataaaacacggattgataatcccatgccattacttcg
gacaacggtagagccgcaaaagccggagcaaagggaagccctgttaaatgccctcgcagagattgctgatacagaccctc
ttttgcattttgacattgatactgttacacatgagattatgttatcttttttgggaaaagtacagttagaagttatttgt
tcgctattagaagaaaaatatcatgtgggcgtggctatgaaagagccttcggttatttatctggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgcccaacccgttttgggcatccatcggactgtctgttacaccactcccgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttctcaaaacgctgtcagggatggt
atccgttacgggctggagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaactaatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttaccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7209|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcactg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgataaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgtgcgggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgccgccctatgcggcagcgttttcaaggtggagtatacagattgcggccagcggcgtgtcta
tctacggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggagaaattgttattttagctgatgatact
ttgaaactgaacgacattctaggaaatgaaaaactcctgcctcataaaacacggattgataatcccatgccattacttcg
gacaacggtagagccgcaaaagccggagcaaagggaagccctgttaaatgccctcgcagagattgctgatacagaccctc
ttttgcattttgacattgatactgttacacatgagattatgttatcttttttgggaaaagtacagttagaagttatttgt
tcgctattagaagaaaaatatcatgtgggcgtggctatgaaagagccttcggttatttatctggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgcccaacccgttttgggcatccatcggactgtctgttacaccactcccgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaactaatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7210|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccacttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagtcaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgataaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgtgcgggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgccgccctatgcggcagcgttttcaaggtggagtatacagattgcggccagcggcgtgtcta
tctacggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggacccaacccggctccctcgtaaaaggtggcgtgaggaccccctccccatgctgcg
gacgtcgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgcttcgaggtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccatcggactgtctgttacaccactcccgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcagggacgc
aactgctggaaccttatctctccttcaccctctatgcgccccgggaatatctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggtccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggcctcttacaccaacgggcagagcgtatgccttacagaactgaaagggtatcaggccgctg
tcggcaagccagtcatccagccccgccgtccaaacagccgcctggacaaggtgcgctatatgtttcagaagataatgtaa

>>MEG_7211|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcaaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagtcaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgataaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgtgcgggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgccgccctatgcggcagcgttttcaaggtggagtatacagattgcggccagcggcgtgtcta
tctacggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggacccaacccggctccctcgtaaaaggtggcgtgaggaccccctccccatgctgcg
gacgtcgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgctgcgaggtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccatcggactgtctgttacaccactcccgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcagggacgc
aactgctggaaccttatctctccttcaccctctatgcgccccgggaatatctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggtccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggcctcttacaccaacgggcagagcgtatgccttacagaactgaaagggtatcaggccgctg
tcggcaagccagtcatccagccccgccgtccaaacagccgcctggacaaggtgcgctatatgtttcagaagataatgtaa

>>MEG_7212|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgcttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagtcaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgataaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgtgcgggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgccgccctatgcggcagcgttttcaaggtggagtatacagattgcggccagcggcgtgtcta
tctacggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggacccaacccggctccctcgtaaaaggtggcgtgaggaccccctccccatgctgcg
gacgtcgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgctgcgaggtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccatcggactgtctgttacaccactcccgc
ttggctccggtgtacaatacaagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcagggacgc
aactgctggaaccttatctctccttcaccctctatgcgccccgggaatatctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggtccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcagagcgtatgccttacagaactgaaagggtatcaggccgctg
tcggcaagccagtcatccagccccgccgtccaaacagccgcctggacaaggtgcgccatatgttcagtaagatcacttga

>>MEG_7213|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagtcaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgataaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgtgcgggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgccgccctatgcggcagcgttttcaaggtggagtatacagattgcggccagcggcgtgtcta
tctacggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggacccaacccggctccctcgtaaaaggtggcgtgaggaccccctccccatgctgcg
gacgacgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgttgcgaagtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaaccctccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccataggactgtctgttacaccactctcgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcggggacgc
agctgctggaaccttatctctccttcatcctctatgcgccccaggaatacctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggcccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcggagcgtatgccttacagagctgaaaggatatcaggccgctg
tcggtcagccggtcatccagccccgccgtccaaacagccgcctggacaaggtgcgccatatgtttcagaaggtaatgtaa

>>MEG_7214|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagtcaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgataaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgtgcgggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgccgccctatgcggcagcgttttcaaggtggagtatacagattgcggccagcggcgtgtcta
tctacggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggacccaacccggctccctcgtaaaaggtggcgtgaggaccccctccccatgctgcg
gacgtcgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgctgcgaggtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccataggactgtctgttacaccactctcgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcagggacgc
aactgctggaaccttatctctccttcaccctctatgcgccccgggaatatctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggtccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcagagcgtatgccttacagaactgaaaggatatcaggccgctg
tcggcaagccggtcatccagccccgccgtccaaacagccgcctggacaaggtgcgccatatgtttcagaaggtaatgtaa

>>MEG_7215|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagtcaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgataaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgtgcgggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgccgccctatgcggcagcgttttcaaggtggagtatacagattgcggccagcggcgtgtcta
tctacggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggacccaacccggctccctcgtaaaaggtggcgtgaggaccccctccccatgctgcg
gacgtcgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgctgcgaggtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccataggactgtctgttacaccactctcgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcagggacgc
aactgctggaaccttatctctccttcaccctctatgcgccccgggaatatctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggtccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcagagcgtatgccttacagaactgaaagggtatcaggccgctg
tcggcaagccagtcatccagccccgccgtccaaacagccgcctggacaaggtgcgctatatgtttcagaagataatgtaa

>>MEG_7216|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagtcaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgataaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgtgcgggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgccgccctatgcggcagcgttttcaaggtggagtatacagattgcggccagcggcgtgtcta
tctacggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggacccaacccggctccctcgtaaaaggtggcgtgaggaccccctccccatgctgcg
gacgtcgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgctgcgaggtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccataggactgtctgttacaccactctcgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcagggacgc
aactgctggaaccttatctctccttcaccctctatgcgccccgggaatatctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggtccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcggagcgtatgccttacagagctgaaaggatatcaggccgctg
tcggtcagccggtcatccagccccgccgtccaaacagccgcctggacaaggtgcgccatatgtttcagaaggtaatgtaa

>>MEG_7217|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagtcaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgataaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgtgcgggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgccgccctatgcggcagcgttttcaaggtggagtatacagattgcggccagcggcgtgtcta
tctacggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggacccaacccggctccctcgtaaaaggtggcgtgaggaccccctccccatgctgcg
gacgtcgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgctgcgaggtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccatcggactgtctgttacaccactcccgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcagggacgc
aactgctggaaccttatctctccttcaccctctatgcgccccgggaatatctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggtccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcagagcgtatgccttacagaactgaaagggtatcaggccgctg
tcggcaagccagtcatccagccccgccgtccaaacagccgcctggacaaggtgcgctatatgtttcagaagataatgtaa

>>MEG_7218|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagtcaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgatgcattattgga
aaagtatatcgcaggagaaccaatcagccaggaaaaacttgcgcgggaggaacagcggcgggttcaagaagcctccctgt
ttccggtctatcatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacaggactgttccaaccg
attggggaacaggggagcgccaccctatgcggcagcgttttcaaggttgagtacaccgattgcggccagcggcgtgtcta
tctgcggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggcgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggatcaaacccggctccctcgtaaaaggtggcgcgaggcccccctccccatgctgcg
gacgacgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgctgcgaagtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggtcgtttcc
gctttgctgtcggaaaaatacaagattgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatctatcggactgtctgttacaccactcccgc
ttggctccggcgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccagtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcggggacgc
agctgctggaaccttatctctccttcaccctctatgcgccccaggaatacctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggcccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcagagcgtatgccttacagagctaaaagggtatcaggccgctg
tcggccagccggtcatccagccccgccgtccaaacaaccgcctggacaaggtgcgccatatgtttcagaaggtaatgtaa

>>MEG_7219|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagttaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgatgaattattgga
aaagtatatcgcaggagaaccaatcagccggaaaaaacttgcgcgggaggaacagcagcgggttcaagacgcctccctgt
tcccagtctatcatggcagcgccaaaaatggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggggcgccgccctatgcggcagcgttttcaaggttgagtacaccgattgcggccagcggcgtgtcta
tctacggttatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatcagggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggaccaaacccggctccctcgtaaaaggtggcgcgaggaccccctccccatgctgcg
gacgacgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgttgcgaagtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaaccctccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccataggactgtctgttacaccactctcgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcggggacgc
agctgctggaaccttatctctccttcatcctctatgcgccccaggaatacctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggcccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcggagcgtatgccttacagagctgaaaggatatcaggccgctg
tcggtcagccggtcatccagccccgccgtccaaacagccgcctggacaaggtgcgccatatgtttcagaaggtaatgtaa

>>MEG_7220|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagttaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgatgaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgcgcgggaggaacagcagcgggttcaagacgcctccctgt
tcccagtctatcatggcagcgccaaaaatggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggggcgccgccctatgcggcagcgttttcaaggttgagtacaccgattgcggccagcggcgtgtcta
tctacggttatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatcagggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggaccaaacccggctccctcgtaaaaggtggcgcgaggaccccctccccatgctgcg
gacgacgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgttgcgaagtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaaccctccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccataggactgtctgttacaccactctcgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaangtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcggggacgc
agctgctggaaccttatctctccttcatcctctatgcgccccaggaatacctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggcccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcggagcgtatgccttacagagctgaaaggatatcaggccgctg
tcggtcagccggtcatccagccccgccgtccaaacagccgcctggacaaggtgcgccatatgtttcagaaggtaatgtaa

>>MEG_7221|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagttaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgatgaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgcgcgggaggaacagcagcgggttcaagacgcctccctgt
tcccagtctatcatggcagcgccaaaaatggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggggcgccgccctatgcggcagcgttttcaaggttgagtacaccgattgcggccagcggcgtgtcta
tctacggttatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatcagggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggaccaaacccggctccctcgtaaaaggtggcgcgaggaccccctccccatgctgcg
gacgacgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgttgcgaagtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaaccctccgtcatttatatggagcggccgctcaaagc
agccagccccaccatccatatcgaggtgccgcccaacccgttttgggcatccataggactgtctgttacaccactctcgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcggggacgc
agctgctggaaccttatctctccttcatcctctatgcgccccaggaatacctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggcccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcggagcgtatgccttacagagctgaaaggatatcaggccgctg
tcggtcagccggtcatccagccccgccgtccaaacagccgcctggacaaggtgcgccatatgtttcagaaggtaatgtaa

>>MEG_7222|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagttaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgatgaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgcgcgggaggaacagcagcgggttcaagacgcctccctgt
tcccagtctatcatggcagcgccaaaaatggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggggcgccgccctatgcggcagcgttttcaaggttgagtacaccgattgcggccagcggcgtgtcta
tctacggttatacagcggaacgctgcgcctgcgggatacggtggccctgggcgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatcagggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggaccaaacccggctccctcgtaaaaggtggcgcgaggaccccctccccatgctgcg
gacgacgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgttgcgaagtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaaccctccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccataggactgtctgttacaccactctcgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcggggacgc
agctgctggaaccttatctctccttcatcctctatgcgccccaggaatacctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggcccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcggagcgtatgccttacagagctgaaaggatatcaggccgctg
tcggtcagccggtcatccagccccgccgtccaaacagccgcctggacaaggtgcgccatatgtttcagaaggtaatgtaa

>>MEG_7223|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagttaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgatgaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgcgcgggaggaacagcagcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaatggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggggcgccgccctatgcggcagcgttttcaaggttgagtacaccgattgcggccagcggcgtgtcta
tctacggttatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatcagggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggaccaaacccggctccctcgtaaaaggtggcgcgaggaccccctccccatgctgcg
gacgacgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgttgcgaagtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccatcggactgtctgttacaccactcccgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcagggacgc
aactgctggaaccttatctctccttcaccctctatgcgccccgggaatatctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggtccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcagagcgtatgccttacagaactgaaagggtatcaggccgctg
tcggcaagccagtcatccagccccgccgtccaaacagccgcctggacaaggtgcgctatatgtttcagaagataatgtaa

>>MEG_7224|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaaaataatcaatattggaattcttgcccatgtagacgctggaaagacgaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgtttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagttaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggcgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatgaacattcccaccgttatctttatcaacaagatcgaccaggctg
gcgttgatttgcagagcgtggttcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgatgaattattgga
aaagtatatcgcaggagaaccaatcagccgggaaaaacttgtgcgggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctattatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgccgccctatgcggcagcgttttcaaggtggagtatacagattgcggccagcggcgtgtcta
tctacggctatacagcggaacgctgcgcctgcgggatacggtggccctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggacccaacccggctccctcgtaaaaggtggcgtgaggaccccctccccatgctgcg
gacgtcgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgctgcgaggtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccatcggactgtctgttacaccactcccgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcagggacgc
aactgctggaaccttatctctccttcaccctctatgcgccccgggaatatctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggtccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcagagcgtatgccttacagaactgaaagggtatcaggccgctg
tcggcaagccagtcatccagccccgccgtccaaacagccgcctggacaaggtgcgccatatgtttcagaaggtaatgtaa

>>MEG_7225|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaacattatcaatatcgggattcttgcccatgtagacgctggaaagacaaccttgacggagagcctgctatatgccag
cggagccatttcagaaccggggagcgtcgaaaaagggacaacgaggacggacaccatgcttttggagcggcagcgtggga
ttaccattcaagcggcagtcacttccttccagtggcacagatgtaaagtcaacattgtggatacgcccggccacatggat
tttttggcggaggtgtaccgctctttggctgttttagatggggccatcttggtgatctccgctaaagatggtgtgcaggc
ccagacccgtattctgttccatgccctgcggaaaatggacattcccaccgttatctttatcaataagatcgaccaggctg
gcgttgatttgcagggcgtgtatcagtctgttcgggataagctctccgccgatattatcatcaagcagacggtgtcgctg
tccccggaaatagtcctggaggaaaataccgacatagaagcatgggatgcggtcatcgaaaataacgatgaattattgga
aaagtatatcgcaggagaaccaatcagccgggaagaacttgcgcaggaggaacagcggcgggttcaagacgcctccctgt
tcccggtctatcatggcagcgccaaaaagggccttggcattcaaccgttgatggatgcggtgacagggctgttccaaccg
attggggaacaggggagcgacgccctatgcggcagcgttttcaaggtggagtatacagattgtggccagcggctcatcta
tttgcggctatacagcggaacgctgcgcctgcgggatacggtggctctggccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggaaattgttcggacagacaccgcttatccgggtgaaattgttatccttcccagcgacagc
gtgaggttaaacgatgtattaggggacccaacccggctccctcgtaaaaggtggcgtgaggaccccctccccatgctgcg
gacgtcgattgcgccgaaaacggcagcgcaaagagaacggctgctggacgctcttacgcaacttgcggatactgacccgc
ttttgcgctgcgaggtggattccatcacccatgagatcattctttcttttttgggccgggtgcagttggaggttgtttcc
gctttgctgtcggaaaaatacaagcttgaaacagtggtaaaggaacccaccgtcatttatatggagcggccgctcaaagc
agccagccacaccatccatatcgaggtgccgcccaacccgttttgggcatccatcggactgtctgttacaccactcccgc
ttggctccggtgtacaatacgagagccgggtttcgctgggatacttgaaccagagttttcaaaacgctgtcagggatggt
atccgttacgggctggagcagggcttgttcggctggaacgtaacggactgtaagatttgctttgaatacgggctttatta
cagtccggtcagcacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaaggaatcagggacgc
aactgctggaaccttatctctccttcaccctctatgcgccccgggaatatctttccagggcttatcatgatgcaccgaaa
tactgtgccaccatcgaaacggtccaggtaaaaaaggatgaagttgtctttactggcgagattcccgcccgctgtataca
ggcataccgtactgatctggccttttacaccaacgggcagagcgtatgccttacagaactgaaagggtatcaggccgctg
tcggcaagccagtcatccagccccgccgtccaaacagccgcctggacaaggtgcgccatatgttcagtaagatcactggt
tga

>>MEG_7226|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
atgaacattatcaatatcgggattcttgcccatgtagatgcgggcaagacgacactgacagaaagcctgctgtatgccag
cggaaccatttcagagccggggagcgtcgaaaaagggacaacgagaacggacactatgtttttggagcggcagcgtggaa
ttaccattcaaacggcagtcacttctttccagtggcacagttgtaaagtcaatattgtggatactcccggccacatggat
ttcttggcagaggtataccgctctctggctgttttggacggggccatcttggtgctctccgctaaagatggcgtgcaggc
ccagacccgtgttctgttccatgccctacggaaattgaacatccccaccattatctttatcaacaagatcgaccaggttg
gcattgatttggagagcgtatatcagtctgttcgggataagctctccgctgatattatcatcaagcagacagtgtcgctg
tcctcgaaaataactctgacagaaaacactagtgcagaggtttgggattcggtcatcgaaaataacgatgagttattggc
aaagtatatcgcaggagaatcaatcagtcagaaagaacttgcgcaagaagaacagcggcgagttcaagacgcctccctgc
tcccggtctatcatggtagcgccaaaaacggccttggcattcaacagttgatggatgcggtgatagggctgttccaatcg
accaaggaacaggggagcgccgccctgtgcggtagagtttttaaggtggagtatacagattgcggccagaggcttgtcta
tctgcggctatacagcggaacgctgcgtctgcgggatacggtggccctagccgggagagaaaagctgaaaatcacagaga
tgcgtattccatccaaaggggagattgttcggacagataccgcccataagggcgaaattgtcatccttcccagcgacagc
ttgagattaaacgatatattgggggacaaaacccaacttcctcgtgaaatgtggagtgatgttcccttccctatgctgcg
gacgacgattacgccaaaaacggcagagcaaagagaccggttgctggacgctcttacgcaaattgcggatactgacccgc
ttttgcactacgaggtggattccaccacccatgagatcattctttcttttttgggtcggatgcagttggaggttgtttcc
gctttgctgacggaaaaatacaagattgaaacagcagtgaaggaacccaccgtcatttatttagagcggccgctcaaagt
ggccagtcacaccatccatatcgaggtgccgcctaacccgttttgggcatctatcggactgtctgttacaccgctcccgc
ttggctccggtgtaaaatacgagagccgggtttccctgggatacctgaaccagagttttcaaaacgctgtcatggatggt
atccgttacggtttggggcaaggcttgtgtggctggaacgtaacggactgtaagatttgctttgaatacggactttacta
tagcccggtcagtacgccggcggacttccgctcattggccccgattgtattggaacaggcattgaagaaatctgggacgc
agttgctggaaccttatctctccttcaccctctatgcgccccaggaatacctttccagggcttatcatgatgcgccgaaa
tactgtgccaccatcgaaacggcccagataaaaaaggatgaagttgtctttactggcgagattcccgcccgttgcataca
ggcataccgtactgatttggccttttacaccaacgggcggagtgtgtgcctgacggaactgaaagggtatcaggccactg
tcggcgagccaatcatccagccccgtcgtccaaacagccgtttggataaggtgcgccatatgttcagtaagattccttga

>>MEG_7227|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCAGCGGGTTCAAGACGCCTCCCTGT
TCCCAGTCTATCATGGCAGCGCCAAAAATGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGGGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGCGGCCAGCGGCGTGTCTA
TCTACGGTTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCAGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGACCCCCTCCCCATGCTGCG
GACGACGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGTTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCTCCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATAGGACTGTCTGTTACACCACTCTCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCGGGGACGC
AGCTGCTGGAACCTTATCTCTCCTTCATCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGCCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCGGAGCGTATGCCTTACAGAGCTGAAAGGATATCAGGCCGCTG
TCGGTCAGCCGGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAAGGTGCGCCATATGTTTCAGAAGGTAATGTAA

>>MEG_7228|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTATATCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCAGCGGGTTCAAGACGCCTCCCTGT
TCCCAGTCTATCATGGCAGCGCCAAAAATGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGGGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGAGGCTTGTCTA
TCTGCGGCTATACAGCGGAACGCTGCGTCTGCGGGATACGGTGGCCCTAGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAGATTGTTCGGACAGATACCGCCCATAAGGGCGAAATTGTCATCCTTCCCAGCGACAGC
TTGAGATTAAACGATATATTGGGGGACAAAACCCAACTTCCTCGTGAAATGTGGAGTGATGTTCCCTTCCCTATGCTGCG
GACGACGATTACGCCAAAAACGGCAGAGCAAAGAGACCGGTTGCTGGACGCTCTTACGCAAATTGCGGATACTGACCCGC
TTTTGCACTACGAGGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCACCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATCGGACTGTCTGTTACACCACTCCCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCAGGGACGC
AACTGCTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCGGGAATATCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGTCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGTTGCATACA
GGCATACCGTACTGATTTGGCCTTTTACACCAACGGGCGGAGTGTGTGCCTGACGGAACTGAAAGGGTATCAGGCCACTG
TCGGCGAGCCAATCATCCAGCCCCGTCGTCCAAACAGCCGTTTGGATAAGGTGCGCCATATGTTCAGTAAGATTCCTTGA

>>MEG_7229|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
AAAGGGAGGACAATCACATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAG
AGCCTGCTATATGCCAGCGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTT
GGAGCGGCAGCGTGGGATTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATA
CGCCCGGCCACATGGATTTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCT
AAAGATGGCGTGCAGGCCCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAA
CAAGATCGACCAGGCTGGCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCA
AGCAGACGGTGTCGCTGTCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAAT
AACGATGAATTATTGGAAAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCAGCGGGT
TCAAGACGCCTCCCTGTTCCCAGTCTATCATGGCAGCGCCAAAAATGGCCTTGGCATTCAACCGTTGATGGATGCGGTGA
CAGGGCTGTTCCAACCGATTGGGGAACAGGGGGGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGC
GGCCAGCGGCGTGTCTATCTACGGTTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGGCGGGAGAGAAAA
GCTGAAAATCACAGAGATGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCAGGGTGAAATTGTTA
TCCTTCCCAGCGACAGCGTGAGGTTAAACGATGTATTAGGGGACCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGAC
CCCCTCCCCATGCTGCGGACGACGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACT
TGCGGATACTGACCCGCTTTTGCGTTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGC
AGTTGGAGGTTGTTTCCGCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCTCCGTCATTTATATG
GAGCGGCCGCTCAAAGCAGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATAGGACTGTC
TGTTACACCACTCTCGCTTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAA
ACGCTGTCAGGGATGGTATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTT
GAATACGGGCTTTATTACAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATT
GAAGGAATCGGGGACGCAGCTGCTGGAACCTTATCTCTCCTTCATCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTT
ATCATGATGCACCGAAATACTGTGCCACCATCGAAACGGCCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATT
CCCGCCCGCTGTATACAGGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCGGAGCGTATGCCTTACAGAGCTGAA
AGGATATCAGGCCGCTGTCGGTCAGCCGGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAAGGTGCGCCATATGT
TTCAGAAGGTAATGTAA

>>MEG_7230|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCAGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAATGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGGGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGCGGCCAGCGGCGTGTCTA
TCTACGGTTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCAGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGACCCCCTCCCCATGCTGCG
GACGACGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGTTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCACCGTCATTTATATGGAGCGACCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATCGGACTGTCTGTTACACCACTCCCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCAGGGACGC
AACTGCTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCGGGAATATCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGTCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCAGAGCGTATGCCTTACAGAACTGAAAGGGTATCAGGCCGCTG
TCGGCAAGCCAGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAAGGTGCGCTATATGTTTCAGAAGATAATGTAA

>>MEG_7231|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCAGCGGGTTCAAGACGCCTCCCTGT
TCCCAGTCTATCATGGCAGCGCCAAAAATGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGGGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGCGGCCAGCGGCGTGTCTA
TCTACGGTTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCAGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGACCCCCTCCCCATGCTGCG
GACGGCGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGTTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCTCCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATAGGACTGTCTGTTACACCACTCTCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCGGGGACGC
AGCTGCTGGAACCTTATCTCTCCTTCATCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGCCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCGGAGCGTATGCCTTACAGAGCTGAAAGGATATCAGGCCGCTG
TCGGTCAGCCGGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAAGGTGCGCCATATGTTTCAGAAGGTAATGTAA

>>MEG_7232|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAACATTATCAATATCGGGATTCTTGCCCATGTAGATGCGGGCAAGACGACACTGACAGAAAGCCTGCTGTATGCCAG
CGGAACCATTTCAGAGCCGGGGAGCGTCGAAAAAGGGACAACGAGAACGGACACTATGTTTTTGGAGCGGCAGCGTGGAA
TTACCATTCAAACGGCAGTCACTTCTTTCCAGTGGCACAGTTGTAAAGTCAACATTGTGGATACTCCCGGCCACATGGAT
TTCTTGGCAGAGGTATACCGCTCTCTGGCCGTTTTGGACGGGGCCATCTTGGTGCTCTCCGCTAGAGATGGCGTACAGGC
CCAGACCCGAGTTCTGTTCCATGCCCTACGGAAATTGAACATCCCCACCATTATCTTTATCAACAAGATCGACCAGGTTG
ACATTGATTTGGAGGGCGTATATCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTATCGCTG
TCCCCGGAAATAGTTCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGGATTATTGGA
AAAGTATATCGCAGGAGAGCCAATCAGCCGGGAAGAACTTGCGCGGGAGGAACAGCGGCGGGTTCAAGCCGCTTCCCTGT
TCCCAGTCTATCATGGTAGCGCCAAAAACGGCCTTGGCATTCAACGGTTGATGGATGCGGTGATAGGGCTGTTCCAACCG
ACCAAGGAACAGGGGCGCACCGCCCTGTGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGAGGCTTGTCTA
TCTGCGGCTATACAGCGGAACGCTGCGTCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAGATTGTTCGGACAGATACCGCCCATAAGGGCGAAATTGTCATCCTTCCCAGCGACAGT
TTGAGATTAAACGATATATTGGGGGACAAAACCCAACTTCCTCGTGAAATGTGGAGTGATGCTCCCTTCTCTATGCTGCG
GACAACGATTACGCCAAAAACGGCAGAGCAAAGAGATCGGTTGCTGGACGCTCTTACGCAAATTGCGGATACTGACCCGC
TTTTGTGCTACGAGGTGGATTCCATCACCCAAGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGGCGGAAAAGTATAAGATTGAAACAGCGGTGAAGGAACCCACCGTCATTTATTTAGAGCGGCCGCTCAAAGT
GGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATCGGACTGTCTGTTACGCCGCTCCCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCCCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCATGGATGGT
ATCCGTTACGGTCTGGAGCAAGGCTTGTGTGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
TAGCCCGGTCAGCACGCCGGCGGACTTTCGCTCATTGGCCCCGATTGTATTGGAACTGGCATTAAAGGAATCAGGGACAC
AGTTGCTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTTATCATGATGCGCCGAAA
TATTGTGCCACCATCGAAACGGCCCAGATAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGTTGCATACA
GGCATACCGTACTGATTTGGCCTCTTACACCAATGGGCGGAGCGTGTGCCTGACGGAACTGAAAGGGTATCAGGCCGCTG
TCGGCCAGCCGGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAGGGTGCGCCATATGTTTCAGAAGGTAATGTAA

>>MEG_7233|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCAGCGGGTTCAAGACGCCTCCCTGT
TCCCAGTCTATCATGGCAGCGCCAAAAATGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGGGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGCGGCCAGCGGCGTGTCTA
TCTACGGTTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCAGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGACCCCCTCCCCATGCTGCG
GACGACGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGTTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCTCCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATAGGACTGTCTGTTACACCACTCTCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCGGGGACGC
AGCTGCTGGAACCTTATCTCTCCTTCATCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGCCCAGGTAAAAAAGGATGAAGTTGTTTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCGGAGCGTATGCCTTACAGAGCTGAAAGGATATCAGGCCGCTG
TCGGTCAGCCGGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAAGGTGCGCCATATGTTTCAGAAGGTAATGTAA

>>MEG_7234|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGTGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTAGGAAATGAAAAACTCCTGCCTCATAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACACATGAGATTATGTTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGCTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAAGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGACATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTAATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>>MEG_7235|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGTGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTAGGAAATGAAAAACTCCTGCCTCATAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACACATGAGATTATGTTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGCTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAAGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTAATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>>MEG_7236|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGTGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGTGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTAGGAAATGAAAAACTCCTGCCTCATAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACACATGAGATTATGTTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGCTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAAGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTAATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTGA

>>MEG_7237|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCATATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGTGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTAGGAAATGAAAAACTCCTGCCTCATAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACACATGAGATTATGTTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGCTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTAATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA