MEGAResFrom MEG, the Microbial Ecology Group

TETW

The tetW gene encodes a tetracycline ribosomal protection protein.

References

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>Tet|tetW_6_FN396364|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCAGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAATGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGGGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGCGGCCAGCGGCGTGTCTA
TCTACGGTTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCAGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGACCCCCTCCCCATGCTGCG
GACGACGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGTTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCACCGTCATTTATATGGAGCGACCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATCGGACTGTCTGTTACACCACTCCCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCAGGGACGC
AACTGCTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCGGGAATATCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGTCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCAGAGCGTATGCCTTACAGAACTGAAAGGGTATCAGGCCGCTG
TCGGCAAGCCAGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAAGGTGCGCTATATGTTTCAGAAGATAATGTAA

>Tet|TetW|AJ222769|3687-5606|1920|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCAGCGGGTTCAAGACGCCTCCCTGT
TCCCAGTCTATCATGGCAGCGCCAAAAATGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGGGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGCGGCCAGCGGCGTGTCTA
TCTACGGTTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCAGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGACCCCCTCCCCATGCTGCG
GACGACGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGTTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCTCCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATAGGACTGTCTGTTACACCACTCTCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCGGGGACGC
AGCTGCTGGAACCTTATCTCTCCTTCATCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGCCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCGGAGCGTATGCCTTACAGAGCTGAAAGGATATCAGGCCGCTG
TCGGTCAGCCGGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAAGGTGCGCCATATGTTTCAGAAGGTAATGTAA

>Tet|tetW_5_AJ427421|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCAGCGGGTTCAAGACGCCTCCCTGT
TCCCAGTCTATCATGGCAGCGCCAAAAATGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGGGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGCGGCCAGCGGCGTGTCTA
TCTACGGTTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCAGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGACCCCCTCCCCATGCTGCG
GACGACGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGTTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCTCCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATAGGACTGTCTGTTACACCACTCTCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCGGGGACGC
AGCTGCTGGAACCTTATCTCTCCTTCATCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGCCCAGGTAAAAAAGGATGAAGTTGTTTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCGGAGCGTATGCCTTACAGAGCTGAAAGGATATCAGGCCGCTG
TCGGTCAGCCGGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAAGGTGCGCCATATGTTTCAGAAGGTAATGTAA

>Tet|tetW_1_DQ060146|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAGAGCCTGCTATATGCCAG
CGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTTGGAGCGGCAGCGTGGGA
TTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCAGCGGGTTCAAGACGCCTCCCTGT
TCCCAGTCTATCATGGCAGCGCCAAAAATGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGGGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGCGGCCAGCGGCGTGTCTA
TCTACGGTTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCAGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGACCCCCTCCCCATGCTGCG
GACGGCGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGTTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCTCCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATAGGACTGTCTGTTACACCACTCTCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCGGGGACGC
AGCTGCTGGAACCTTATCTCTCCTTCATCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGCCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCGGAGCGTATGCCTTACAGAGCTGAAAGGATATCAGGCCGCTG
TCGGTCAGCCGGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAAGGTGCGCCATATGTTTCAGAAGGTAATGTAA

>Tet|tetW_2_AY049983|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
ATGAACATTATCAATATCGGGATTCTTGCCCATGTAGATGCGGGCAAGACGACACTGACAGAAAGCCTGCTGTATGCCAG
CGGAACCATTTCAGAGCCGGGGAGCGTCGAAAAAGGGACAACGAGAACGGACACTATGTTTTTGGAGCGGCAGCGTGGAA
TTACCATTCAAACGGCAGTCACTTCTTTCCAGTGGCACAGTTGTAAAGTCAACATTGTGGATACTCCCGGCCACATGGAT
TTCTTGGCAGAGGTATACCGCTCTCTGGCCGTTTTGGACGGGGCCATCTTGGTGCTCTCCGCTAGAGATGGCGTACAGGC
CCAGACCCGAGTTCTGTTCCATGCCCTACGGAAATTGAACATCCCCACCATTATCTTTATCAACAAGATCGACCAGGTTG
ACATTGATTTGGAGGGCGTATATCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTATCGCTG
TCCCCGGAAATAGTTCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGGATTATTGGA
AAAGTATATCGCAGGAGAGCCAATCAGCCGGGAAGAACTTGCGCGGGAGGAACAGCGGCGGGTTCAAGCCGCTTCCCTGT
TCCCAGTCTATCATGGTAGCGCCAAAAACGGCCTTGGCATTCAACGGTTGATGGATGCGGTGATAGGGCTGTTCCAACCG
ACCAAGGAACAGGGGCGCACCGCCCTGTGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGAGGCTTGTCTA
TCTGCGGCTATACAGCGGAACGCTGCGTCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAGATTGTTCGGACAGATACCGCCCATAAGGGCGAAATTGTCATCCTTCCCAGCGACAGT
TTGAGATTAAACGATATATTGGGGGACAAAACCCAACTTCCTCGTGAAATGTGGAGTGATGCTCCCTTCTCTATGCTGCG
GACAACGATTACGCCAAAAACGGCAGAGCAAAGAGATCGGTTGCTGGACGCTCTTACGCAAATTGCGGATACTGACCCGC
TTTTGTGCTACGAGGTGGATTCCATCACCCAAGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGGCGGAAAAGTATAAGATTGAAACAGCGGTGAAGGAACCCACCGTCATTTATTTAGAGCGGCCGCTCAAAGT
GGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATCGGACTGTCTGTTACGCCGCTCCCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCCCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCATGGATGGT
ATCCGTTACGGTCTGGAGCAAGGCTTGTGTGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
TAGCCCGGTCAGCACGCCGGCGGACTTTCGCTCATTGGCCCCGATTGTATTGGAACTGGCATTAAAGGAATCAGGGACAC
AGTTGCTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTTATCATGATGCGCCGAAA
TATTGTGCCACCATCGAAACGGCCCAGATAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGTTGCATACA
GGCATACCGTACTGATTTGGCCTCTTACACCAATGGGCGGAGCGTGTGCCTGACGGAACTGAAAGGGTATCAGGCCGCTG
TCGGCCAGCCGGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAGGGTGCGCCATATGTTTCAGAAGGTAATGTAA

>Tet|EU434751.1|gene2|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETW
AAAGGGAGGACAATCACATGAAAATAATCAATATTGGAATTCTTGCCCATGTAGACGCTGGAAAGACGACCTTGACGGAG
AGCCTGCTATATGCCAGCGGAGCCATTTCAGAACCGGGGAGCGTCGAAAAAGGGACAACGAGGACGGACACCATGTTTTT
GGAGCGGCAGCGTGGGATTACCATTCAAGCGGCAGTCACTTCCTTCCAGTGGCACAGATGTAAAGTTAACATTGTGGATA
CGCCCGGCCACATGGATTTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCT
AAAGATGGCGTGCAGGCCCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAA
CAAGATCGACCAGGCTGGCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCA
AGCAGACGGTGTCGCTGTCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAAT
AACGATGAATTATTGGAAAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCAGCGGGT
TCAAGACGCCTCCCTGTTCCCAGTCTATCATGGCAGCGCCAAAAATGGCCTTGGCATTCAACCGTTGATGGATGCGGTGA
CAGGGCTGTTCCAACCGATTGGGGAACAGGGGGGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGC
GGCCAGCGGCGTGTCTATCTACGGTTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGGCGGGAGAGAAAA
GCTGAAAATCACAGAGATGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCAGGGTGAAATTGTTA
TCCTTCCCAGCGACAGCGTGAGGTTAAACGATGTATTAGGGGACCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGAC
CCCCTCCCCATGCTGCGGACGACGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACT
TGCGGATACTGACCCGCTTTTGCGTTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGC
AGTTGGAGGTTGTTTCCGCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCTCCGTCATTTATATG
GAGCGGCCGCTCAAAGCAGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATAGGACTGTC
TGTTACACCACTCTCGCTTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAA
ACGCTGTCAGGGATGGTATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTT
GAATACGGGCTTTATTACAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATT
GAAGGAATCGGGGACGCAGCTGCTGGAACCTTATCTCTCCTTCATCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTT
ATCATGATGCACCGAAATACTGTGCCACCATCGAAACGGCCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATT
CCCGCCCGCTGTATACAGGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCGGAGCGTATGCCTTACAGAGCTGAA
AGGATATCAGGCCGCTGTCGGTCAGCCGGTCATCCAGCCCCGCCGTCCAAACAGCCGCCTGGACAAGGTGCGCCATATGT
TTCAGAAGGTAATGTAA