MEGAResFrom MEG, the Microbial Ecology Group

TETS

The tetS gene encodes a tetracycline ribosomal protection protein.

References

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>Tet|tetS_1_DQ377340|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETS
TTGAAAATTATTAATATCGGTATCTTAGCACATGTTGATGCAGGAAAAACTACTTTGACAGAAAGCTTACTATACAGTAG
CGGACGAATTAAAGAGTTAGGAAGTGTAGATAGCGGTACAACGAAAACGGATACTATGTTTTTGGAACGCCAGAGAGGTA
TTACTATTCAGACCGCAATAACATCTTTTCAACGGGAAAATGTTAAAGTAAATATTGTAGATACTCCTGGACACATGGAT
TTTTTGGCAGATGTATACCGTTCATTATCTGTTTTGGATGGAGCTATTTTGCTAATCTCTGCAAAAGATGGAGTACAGTC
ACAAACTCGTATACTATTCCATGCACTTAGAAAGATGAACATACCTATAATATTTTTTATTAACAAAATTGATCAAAATG
GAATAAATTTGCCAGATGTTTATCAAGATATTAAGGACAAACTTTCTGACGACATCATAATTAAGCAGACTGTGAATCTA
AATTTGAAACCTTATGTAATAGATTATACTGAACCAGAACAATGGGAGACAGTAATTGTGGGAAATGATTATTTATTAGA
AAAATATACCATTGGGAAAACATTGAATATTGCAGAACTTGAAAAGGAGGAAAACGAAAGAATTCAAAGTTGCTCCTTAT
ATCCTGTTTATCACGGAAGTGCAAAGAATAATATTGGAATTAAACAACTTATAGAGGTAATTACTAGCAAATTATTTTCA
CCCACACAACTCAATTCAGATAAACTTTGTGGAAATGTTTTTAAAGTAGAATATTCAGATGATGGTCAACGGCTTGTCTA
TGTACGTCTTTATAGTGGAACGCTACATTTGCGAGACTCAGTCAATATATCAGAAAAGGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGAGAATTACGCCAGATAGATAAGGCAGAGCCTGGTGAGATTATTATTTTAAAAAATGAGCTT
TTAAAACTAAATAACGTACTTGGAGATAAAAAAAGATTACCACATAGAGAAATTCTTGAGAATCCTCTTCCTATGTTACA
AACAACAATTGAACCATGTAAATCAGTACAAAGAGAAAAGTTACTAGATGCACTTTTTGAAATATCCGATAGTGATCCCC
TTCTACAATATTATGTAGATACAGTAACTCACGAAATTGTGCTATCTTTTTTAGGTGAGGTCCAAATGGAGGTAACTTGT
ACTCTGATTCAAGAAAAATATCATATTGAGATAGAAACAAGAAAACCAACTGTCATTTATATGGAAAGACCATTAAAAAA
ATCTGAATTTACCATTGATATCGAAGTACCTCCAAATCCTTTCTGGGCTTCTATTGGTTTATCTGTAACACCACTTCCTT
TGGGTAGTGGCATTCAGTATGAGAGCCTGGTTTCTCTAGGTTATTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGT
ATACGCTATGGGTGTGAACAAGGATTGTACGGTTGGAAATTAACAGACTGTAAGATCTGTTTTAAGTATGGTCTATATTA
CAGCCCTGTCAGTACGCCAGCAGATTTCCGAATGCTTGCGCCTATTGTACTAGAGCAGGCTTTTAGAAAGAGTGGTACAG
AGTTATTAGAGCCATATCTTAGCTTCGAAATTTATGTACCACAAGAATATCTTTCGAGAGCATATAATGATGCTTCCAAA
TATTGTGCAAATATTTTAAATACTAAGTTAAAAGGTAACGAGGTCATTCTCATTGGTGAAATTCCAGCCCGTTGTATTCA
AGAGTATCGAAACAGTTTAACTTTCTTTACAAATGGACGCAGTGTCTGTTTAACAGAGTTAAAAGGTTATCAGGTTACTA
ACATTAAGTCTGCTTTCCAACCACGTCGTCCAAATAATAGAATAGACAAAGTAAGGCATATGTTTAATAAAATCAACTTA
CATTGA

>Tet|tetS_3_X92946|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETS
TCAATGTAAGTTGATTTTATTAAACATATGCCTTACTTTGTCTATTCTATTATTTGGACGACGTGGTTGGAAAGCAGACT
TAATGTTAGTAACCTGATAACCTTTTAACTCTGTTAAACAGACACTGCGTCCATTTGTAAAGAAAGTTAAACTGTTTCGA
TACTCTTGAATACAACGGGCTGGAATTTCACCAATGAGAATGACCTCGTTACCTTTTAACTTAGTATTTAAAATATTTGC
ACAATATTTGGAAGCATCATTATATGCTCTCGAAAGATATTCTTGTGGTACATAAATTTCGAAGCTAAGATATGGCTCTA
ATAACTCTGTACCACTCTTTCTAAAAGCCTGCTCTAGTACAATAGGCGCAAGCATTCGGAAATCTGCTGGCGTACTGACA
GGGCTGTAATATAGACCATACTTAAAACAGATCTTACAGTCTGTTAATTTCCAACCGTACAATCCTTGTTCACACCCATA
GCGTATACCTTCCATAACTGCATTTTGAAATGATTGATTTAAATAACCTAGAGAAACCAGGCTCTCATACTGAATGCCAC
TACCCAAAGGAAGTGGTGTTACAGATAAACCAATAGAAGCCCAGAAAGGATTTGGAGGTACTTCGATATCAATGGTAAAT
TCAGATTTTTTTAATGGTCTTTCCATATAAATGACAGTTGGTTTTCTTGTTTCTATCTCAATATGATATTTTTCTTGAAT
CAGAGTACAAGTTACCTCCATTTGGACCTCACCTAAAAAAGATAGCACAATTTCGTGAGTTACTGTATCTACATAATATT
GTAGAAGGGGATCACTATCGGATATTTCAAAAAGTGCATCTAGTAACTTTTCTCTTTGTACTGATTTACATGGTTCAATT
GTTGTTTGTAACATAGGAAGAGGATTCTCAAGAATTTCTCTATGTGGTAATCTTTTTTTATCTCCAAGTACGTTATTTAG
TTTTAAAAGCTCATTTTTTAAAATAATAATCTCACCAGGCTCTGCCTTATCTATCTGGCGTAATTCTCCATTTATTGAAG
TATACATTTCTGTAACTTTTATTTTTTCCTTTTCTGATATATTGACTGAGTCTCGCAAATGTAGCGTTCCACTATAAAGA
CGTACATAGACAAGCCGTTGACCATCATCTGAATATTCTACTTTAAAAACATTTCCACAAAGTTTATCTGAATTGAGTTG
TGTGGGTGAAAATAATTTGCTAGTAATTACCTCTATAAGTTGTTTAATTCCAATATTATTCTTTGCACTTCCGTGATAAA
CAGGATATAAGGAGCAACTTTGAATTCTTTCGTTTTCCTCCTTTTCAAGTTCTGCAATATTCAATGTTTTCCCAATGGTA
TATTTTTCTAATAAATAATCATTTCCCACAATTACTGTCTCCCATTGTTCTGGTTCAGTATAATCTATTACATAAGGTTT
CAAATTTAGATTCACAGTCTGCTTAATTATGATGTCGTCAGAAAGTTTGTCCTTAATATCTTGATAAACATCTGGCAAAT
TTATTCCATTTTGATCAATTTTGTTAATAAAAAATATTATAGGTATGTTCATCTTTCTAAGTGCATGGAATAGTATACGA
GTTTGTGACTGTACTCCATCTTTTGCAGAGATTAGCAAAATAGCTCCATCCAAAACAGATAATGAACGGTATACATCTGC
CAAAAAATCCATGTGTCCAGGAGTATCTACAATATTTACTTTAACATTTTCCCGTTGAAAAGATGTTATTGCGGTCTGAA
TAGTAATACCTCTCTGGCGTTCCAAAAACATAGTATCCGTTTTCGTTGTACCGCTATCTACACTTCCTAACTCTTTAATT
CGTCCGCTACTGTATAGTAAGCTTTCTGTCAAAGTAGTTTTTCCTGCATCAACATGTGCTAAGATACCGATATTAATAAT
TTTCAATTTTATTTCCTCCAT

>Tet|TetS|L09756|447-2372|1926|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETS
TTGAAAATTATTAATATCGGTATCTTAGCACATGTTGATGCAGGAAAAACTACTTTGACAGAAAGCTTACTATACAGTAG
CGGAGCAATTAAAGAGTTAGGAAGTGTAGATAGCGGTACAACGAAAACGGATACTATGTTTTTGGAACGCCAGAGAGGTA
TTACTATTCAGACCGCAATAACATCTTTTCAACGGGAAAATGTTAAAGTAAATATTGTAGATACTCCTGGACACATGGAT
TTTTTGGCAGATGTATACCGTTCATTATCTGTTTTGGATGGAGCTATTTTGCTAATCTCTGCAAAAGATGGAGTACAGTC
ACAAACTCGTATACTATTCCATGCACTTAGAAAGATGAACATACCTATAATATTTTTTATTAACAAAATTGATCAAAATG
GAATAAATTTGCCAGATGTTTATCAAGATATTAAGGACAAACTTTCTGACGACATCATAATTAAGCAGACTGTGAATCTA
AATTTGAAACCTTATGTAATAGATTATACTGAACCAGAACAATGGGAGACAGTAATTGTGGGAAATGATTATTTATTAGA
AAAATATACCATTGGGAAAACATTGAATATTGCAGAACTTGAAAAGGAGGAAAACGAAAGAATTCAAAGTTGCTCCTTAT
ATCCTGTTTATCACGGAAGTGCAAAGAATAATATTGGAATTAAACAACTTATAGAGGTAATTACTAGCAAATTATTTTCA
CCCACACAACTCAATTCAGATAAACTTTGTGGAAATGTTTTTAAAGTAGAATATTCAGATGATGGTCAACGGCTTGTCTA
TGTACGTCTTTATAGTGGAACGCTACATTTGCGAGACTCAGTCAATATATCAGAAAAGGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGAGAATTACGCCAGATAGATAAGGCAGAGCCTGGTGAGATTATTATTTTAAAAAATGAGCTT
TTAAAACTAAATAACGTACTTGGAGATAAAAAAAGATTACCACATAGAGAAATTCTTGAGAATCCTCTTCCTATGTTACA
AACAACAATTGAACCATGTAAATCAGTACAAAGAGAAAAGTTACTAGATGCACTTTTTGAAATATCCGATAGTGATCCCC
TTCTACAATATTATGTAGATACAGTAACTCACGAAATTGTGCTATCTTTTTTAGGTGAGGTCCAAATGGAGGTAACTTGT
ACTCTGATTCAAGAAAAATATCATATTGAGATAGAAACAAGAAAACCAACTGTCATTTATATGGAAAGACCATTAAAAAA
ATCTGAATTTACCATTGATATCGAAGTACCTCCAAATCCTTTCTGGGCTTCTATTGGTTTATCTGTAACACCACTTCCTT
TGGGTAGTGGCATTCAGTATGAGAGCCTGGTTTCTCTAGGTTATTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGT
ATACGCTATGGGTGTGAACAAGGATTGTACGGTTGGAAATTAACAGACTGTAAGATCTGTTTTAAGTATGGTCTATATTA
CAGCCCTGTCAGTACGCCAGCAGATTTCCGAATGCTTGCGCCTATTGTACTAGAGCAGGCTTTTAGAAAGAGTGGTACAG
AGTTATTAGAGCCATATCTTAGCTTCGAAATTTATGTACCACAAGAATATCTTTCGAGAGCATATAATGATGCTTCCAAA
TATTGTGCAAATATTTTAAATACTAAGTTAAAAGGTAACGAGGTCATTCTCATTGGTGAAATTCCAGCCCGTTGTATTCA
AGAGTATCGAAACAGTTTAACTTTCTTTACAAATGGACGCAGTGTCTGTTTAACAGAGTTAAAAGGTTATCAGGTTACTA
ACATTAAGTCTGCTTTCCAACCACGTCGTCCAAATAATAGAATAGACAAAGTAAGGCATATGTTTAATAAAATCAACTTA
CATTGA