MEGAResFrom MEG, the Microbial Ecology Group

TETQ

The tetQ gene encodes a tetracycline ribosomal protection protein.

References

  • http://aac.asm.org/content/47/12/3675

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>>MEG_7178|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETQ
atgaatattataaatttaggaattcttgctcacattgatgcaggaaaaacttccgtaaccgagaatctgctgtttgccag
tggagcaacggaaaagtgcggccgtgtggataatggtgacaccataacagactctatggatatagagaaacgtagaggaa
ttactgtccgggcttctacgacatctattatctggaacggggtgaaatgcaatatcattgacactccgggacacatggat
tttattgcggaagtggagcggacattcaaaatgcttgatggagcagtcctcatcttatccgcaaaggaaggcatacaagc
gcagacaaagttgctgttcaatactttacagaagctgcaaatcccgacaattatatttatcaataagattgaccgtgccg
gtgtgaatttggagcgtttgtatctggatataaaaacaaatctgtcgcaagatgtcctgtgtatgcaaactgttgtcgat
ggatcggtttatccagtttgctcccaaacatatataaaggaagaatacaaagaatttgtatgcgaccatgacgacaacat
attggaacgatatttggcggatagcgaaattccaccgactgattattggaatacgataatcgctcttgtggcaaaagcca
aagtctatccggtgctacatggatcagcaatgttcaatatcggcatcaatgagttgatggacgccatcacttcttttata
cttcctccggcatcagtctcagacagactttcagcttatctctataagatagagcatgaccccaaaggacataaaagaag
ttttctaaaaataattgacggaagtctgagacttagagacgttgtaagaatcaacgattcggaaaaatccatcaagatta
aaaatctgaaaactatttatcagggcagagagataaatgttgatgaagtgggtgccaatgatatcgcgattgtagaggat
atggaagattttcgaatcggagattatttaggtgctgagccttgtttgattcaaggattatctcatcagcatcccgctct
caaatcctccgtccggccagacaagcccgaagagaggagcaaggttatatccgctctgaatacattgtggattgaagacc
cgtctttgtccttttccataaactcatatagcgatgaattggaaatctcgttatatggtttgacccaaaaggaaatcata
cagacattgctggaagaacgattttccgtaaaggtccattttgatgagatcaagactatctacaaagaacgacctataaa
aaaggtcaataagattattcagatcgaagtaccacccaacccttactgggccacaatagggctgactcttgaacccttac
cgttaggggcagggttgcaaatcgaaagtgacatctcctatggttatctgaaccattcttttcaaaatgccgtttttgaa
ggaatccgtatgtcttgccaatcaggattacatggatgggaagtgacagatctgaaagtgacttttactcaagccgaata
ttatagcccggtaagtacacctgctgatttcaggcagctgaccccttatgtcttcaggctggctttgcaacagtcaggtg
tggacattctcgaaccgatgctatattttgagttgcagataccccaggaggcaagttccaaagctattacagatttgcaa
aaaatgatgtctgagattgaagacatcagttgcaataatgagtggtgtcatattaaagggaaagttccattaaatacaag
taaagactatgcctcagaagtaagttcgtacactaagggcttaggcatttttatggttaagccatgtgggtatcaaataa
caaaagacggttattctgataatatccgcatgaacgaaaaagataaacttttattcatgttccaaaaatcaatgtcatta
aaataa

>>MEG_7179|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETQ
atgaatattataaatttaggaattcttgctcacattgatgcaggaaaaacttccgtaaccgagaatctgctgtttgccag
tggagcaacggaaaagtgcggccgtgtggataatggtgacaccataacagactctatggatatagagaaacgtagaggaa
ttactgttcgggcttctacgacatctattatctggaatggagtgaaatgcaatatcattgacactccgggacacatggat
tttattgcggaagtggagcggacattcaaaatgcttgatggagcagtcctcatcttatccgcaaaggaaggcatacaagc
gcaaacaaagttgctgttcaatactttacaaaaactgcaaatcccgacaattatatttatcaataaaattgaccgtgacg
gtgtgaatttagagcgtttgtatctggatataaaaacaaatctgtctcaagatgtcctgtttatgcaaactgttgtcgat
ggattggtttatccgatttgctcccaaacatatataaaggaagaatacaaagaatttgtatgcaaccatgacgacaatat
attagaacgatatttggcggatagcgaaatttcaccggctgattattggaatacgataatcgatcttgtggcaaaagcca
aagtctatccggtactacatggatcagcaatgttcaatatcggtatcaatgagttgttggacgccatctcttcttttata
cttcctccagaatcagtctcaaacagactttcagcttatctctataagatagagcatgaccccaaaggacataaaagaag
ttttctaaaaataattgacggaagtctgagacttcgagacattgtaagaatcaacgattcggaaaaattcatcaagatta
aaaatctaaagactatttatcagggcagaaagataaatgttgatgaagtgggggccaatgatatcgcgattgtagaagat
atggaagattttcgaatcggagattatttaggtactaaaccttgtttgattcaagggttatctcatcagcatcccgctct
caaatcctccgtccggccagacaggtccgaagagagaagcaaggtgatatccgctctgaatacattgtggattgaagacc
cgtctttgtccttttccataaactcatatagtgatgaattggaaatctcgttatatggtttgacacaaaaggaaatcata
cagacattgctggaagaacgattttccgtaaaggtccattttgatgagatcaagactatctacaaagaacgacctgtaaa
aaaggtcaataagattattcagatcgaagtgccacccaacccttactgggccacaatagggctgacgcttgaacccttgc
cgttagggacagggttgcaaatcgaaagtgacatctcctatggttatctgaaccattcttttcaaaatgccgtttttgaa
gggattcgtatgtcttgccaatctggtttacatggatgggaagtgactgatctgaaagtaacttttactcaagccgagta
ttatagcccggtaagtacacctgctgatttcagacagctgaccccttatgtcttcaggctggccttgcaacagtcaggtg
tggacattctcgaaccgatgctctattttgagttgcagataccccaagcggcaagttccaaagctattacagatttgcaa
aaaatgatgtctgagattgaagacatcagttgcaataatgagtggtgtcatattaaagggaaagttccatacaatacaag
taaagactacgcctcagaagtaagttcatacactaagggcttaggcgtttttatggtcaagccatgcgggtatcaaataa
caaaaggcgattattctgataatatccgcatgaacgaaaaagataaaattttattcatgttccaaaaatccaatgtcatc
aaaataatggagcggtcaggaaatttctataaggcaatacagtag

>>MEG_7180|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETQ
atgaatattataaatttaggaattcttgctcacattgatgcaggaaaaacttccgtaaccgagaatctgctgtttgccag
tggagcaacggaaaagtgcggccgtgtggataatggtgacaccataacagactctatggatatagagaaacgtagaggaa
ttactgttcgggcttctacgacatctattatctggaatggagtgaaatgcaatatcattgacactccgggacacatggat
tttattgcggaagtggagcggacattcaaaatgcttgatggagcagtcctcatcttatccgcaaaggaaggcatacaagc
gcaaacaaagttgctgttcaatactttacaaaaactgcaaatcccgacaattatatttatcaataaaattgaccgtgacg
gtgtgaatttagagcgtttgtatctggatataaaaacaaatctgtctcaagatgtcctgtttatgcaaactgttgtcgat
ggattggtttatccgatttgctcccaaacatatataaaggaagaatacaaagaatttgtatgcaaccatgacgacaatat
attagaacgatatttggcggatagcgaaatttcaccggctgattattggaatacgataatcgatcttgtggcaaaagcca
aagtctatccggtactacatggatcagcaatgttcaatatcggtatcaatgagttgttggacgccatctcttcttttata
cttcctccagaatcagtctcaaacagactttcagcttatctctataagatagagcatgaccccaaaggacataaaagaag
ttttctaaaaataattgacggaagtctgagacttcgagacattgtaagaatcaacgattcggaaaaattcatcaagatta
aaaatctaaagactatttatcagggcagagagataaatgttgatgaagtgggggccaatgatatcgcgattgtagaagat
atggaagattttcgaatcggagattatttaggtactaaaccttgtttgattcaagggttatctcatcagcatcccgctct
caaatcctccgtccggccagacaggtccgaagagagaagcaaggtgatatccgctctgaatacattgtggattgaagacc
cgtctttgtccttttccataaactcatatagtgatgaattggaaatctcgttatatggtttgacacaaaaggaaatcata
cagacattgctggaagaacgattttccgtaaaggtccattttgatgagatcaagactatctacaaagaacgacctgtaaa
aaaggtcaataagattattcagatcgaagtgccacccaacccttactgggccacaatagggctgacgcttgaacccttgc
cgttagggacagggttgcaaatcgaaagtgacatctcctatggttatctgaaccattcttttcaaaatgccgtttttgaa
gggattcgtatgtcttgccaatctggtttacatggatgggaagtgactgatctgaaagtaacttttactcaagccgagta
ttatagcccggtaagtacacctgctgatttcagacagctgaccccttatgtcttcaggctggccttgcaacagtcaggtg
tggacattctcgaaccgatgctctattttgagttgcagataccccaagcggcaagttccaaagctattacagatttgcaa
aaaatgatgtctgagattgaagacatcagttgcaataatgagtggtgtcatattaaagggaaagttccattaaatacaag
taaagactacgcctcagaagtaagttcatacactaagggcttaggcgtttttatggtcaagccatgcgggtatcaaataa
caaaaggcgattattctgataatatccgcatgaacgaaaaagataaacttttattcatgttccaaaaatcaatgtcatca
aaataa

>>MEG_7181|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETQ
GTGCGTTTCGACAATGCATCTATTGTAGTATATTATTGCTTAATCCAAATGAATATTATAAATTTAGGAATTCTTGCTCA
CATTGATGCAGGAAAAACTTCCGTAACCGAGAATCTGCTGTTTGCCAGTGGAGCAACGGAAAAGTGCGGCCGTGTGGATA
ATGGTGACACCATAACAGACTCTATGGATATAGAGAAACGTAGAGGAATTACTGTTCGGGCTTCTACGACATCTATTATC
TGGAATGGAGTGAAATGCAATATCATTGACACTCCGGGACACATGGATTTTATTGCGGAAGTGGAGCGGACATTCAAAAT
GCTTGATGGAGCAGTCCTCATCTTATCCGCAAAGGAAGGCATACAAGCGCAAACAAAGTTGCTGTTCAATACTTTACAAA
AACTGCAAATCCCGACAATTATATTTATCAATAAAATTGACCGTGACGGTGTGAATTTAGAGCGTTTGTATCTGGATATA
AAAACAAATCTGTCTCAAGATGTCCTGTTTATGCAAACTGTTGTCGATGGATTGGTTTATCCGATTTGCTCCCAAACATA
TATAAAGGAAGAATACAAAGAATTTGTATGCAACCATGACGACAATATATTAGAACGATATTTGGCGGATAGCGAAATTT
CACCGGCTGATTATTGGAATACGATAATCGATCTTGTGGCAAAAGCCAAAGTCTATCCGGTACTACATGGATCAGCAATG
TTCAATATCGGTATCAATGAGTTGTTGGACGCCATCTCTTCTTTTATACTTCCTCCAGAATCAGTCTCAAACAGACTTTC
AGCTTATCTCTATAAGATAGAGCATGACCCCAAAGGACATAAAAGAAGTTTTCTAAAAATAATTGACGGAAGTCTGAGAC
TTCGAGACATTGTAAGAATCAACGATTCGGAAAAATTCATCAAGATTAAAAATCTAAAGACTATTTATCAGGGCAGAGAG
ATAAATGTTGATGAAGTGGGGGCCAATGATATCGCGATTGTAGAAGATATGGAAGATTTTCGAATCGGAGATTATTTAGG
TACTAAACCTTGTTTGATTCAAGGGTTATCTCATCAGCATCCCGCTCTCAAATCCTCCGTCCGGCCAGACAGGTCCGAAG
AGAGAAGCAAGGTGATATCCGCTCTGAATACATTGTGGATTGAAGACCCGTCTTTGTCCTTTTCCATAAACTCATATAGT
GATGAATTGGAAATCTCGTTATATGGTTTGACACAAAAGGAAATCATACAGACATTGCTGGAAGAACGATTTTCCGTAAA
GGTCCATTTTGATGAGATCAAGACTATCTACAAAGAACGACCTGTAAAAAAGGTCAATAAGATTATTCAGATCGAAGTGC
CACCCAACCCTTACTGGGCCACAATAGGGCTGACGCTTGAACCCTTGCCGTTAGGGACAGGGTTGCAAATCGAAAGTGAC
ATCTCCTATGGTTATCTGAACCATTCTTTTCAAAATGCCGTTTTTGAAGGGATTCGTATGTCTTGCCAATCTGGTTTACA
TGGATGGGAAGTGACTGATCTGAAAGTAACTTTTACTCAAGCCGAGTATTATAGCCCGGTAAGTACACCTGCTGATTTCA
GACAGCTGACCCCTTATGTCTTCAGGCTGGCCTTGCAACAGTCAGGTGTGGACATTCTCGAACCGATGCTCTATTTTGAG
TTGCAGATACCCCAAGCGGCAAGTTCCAAAGCTATTACAGATTTGCAAAAAATGATGTCTGAGATTGAAGACATCAGTTG
CAATAATGAGTGGTGTCATATTAAAGGGAAAGTTCCATTAAATACAAGTAAAGACTACGCCTCAGAAGTAAGTTCATACA
CTAAGGGCTTAGGCGTTTTTATGGTCAAGCCATGCGGGTATCAAATAACAAAAGGCGATTATTCTGATAATATCCGCATG
AACGAAAAAGATAAACTTTTATTCATGTTCCAAAAATCAATGTCATCAAAATAA

>>MEG_7182|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETQ
GTGCGTTTCGACAATGCATCTATTGTAGTATATTATTGCTTAATCCAAATGAATATTATAAATTTAGGAATTCTTGCTCA
CATTGATGCAGGAAAAACTTCCGTAACCGAGAATCTGCTGTTTGCCAGTGGAGCAACGGAAAAGTGCGGCCGTGTGGATA
ATGGTGACACCATAACAGACTCTATGGATATAGAGAAACGTAGAGGAATTACTGTTCGGGCTTCTACGACATCTATTATC
TGGAATGGAGTGAAATGCAATATCATTGACACTCCGGGACACATGGATTTTATTGCGGAAGTGGAGCGGACATTCAAAAT
GCTTGATGGAGCAGTCCTCATCTTATCCGCAAAGGAAGGCATACAAGCGCAAACAAAGTTGCTGTTCAATACTTTACAAA
AACTGCAAATCCCGACAATTATATTTATCAATAAAATTGACCGTGACGGTGTGAATTTAGAGCGTTTGTATCTGGATATA
AAAACAAATCTGTCTCAAGATGTCCTGTTTATGCAAACTGTTGTCGATGGATTGGTTTATCCGATTTGCTCCCAAACATA
TATAAAGGAAGAATACAAAGAATTTGTATGCAACCATGACGACAATATATTAGAACGATATTTGGCGGATAGCGAAATTT
CACCGGCTGATTATTGGAATACGATAATCGATCTTGTGGCAAAAGCCAAAGTCTATCCGGTACTACATGGATCAGCAATG
TTCAATATCGGTATCAATGAGTTGTTGGACGCCATCTCTTCTTTTATACTTCCTCCAGAATCAGTCTCAAACAGACTTTC
AGCTTATCTCTATAAGATAGAGCATGACCCCAAAGGACATAAAAGAAGTTTTCTAAAAATAATTGACGGAAGTCTGAGAC
TTCGAGACATTGTAAGAATCAACGATTCGGAAAAATTCATCAAGATTAAAAATCTAAAGACTATTTATCAGGGCAGAAAG
ATAAATGTTGATGAAGTGGGGGCCAATGATATCGCGATTGTAGAAGATATGGAAGATTTTCGAATCGGAGATTATTTAGG
TACTAAACCTTGTTTGATTCAAGGGTTATCTCATCAGCATCCCGCTCTCAAATCCTCCGTCCGGCCAGACAGGTCCGAAG
AGAGAAGCAAGGTGATATCCGCTCTGAATACATTGTGGATTGAAGACCCGTCTTTGTCCTTTTCCATAAACTCATATAGT
GATGAATTGGAAATCTCGTTATATGGTTTGACACAAAAGGAAATCATACAGACATTGCTGGAAGAACGATTTTCCGTAAA
GGTCCATTTTGATGAGATCAAGACTATCTACAAAGAACGACCTGTAAAAAAGGTCAATAAGATTATTCAGATCGAAGTGC
CACCCAACCCTTACTGGGCCACAATAGGGCTGACGCTTGAACCCTTGCCGTTAGGGACAGGGTTGCAAATCGAAAGTGAC
ATCTCCTATGGTTATCTGAACCATTCTTTTCAAAATGCCGTTTTTGAAGGGATTCGTATGTCTTGCCAATCTGGTTTACA
TGGATGGGAAGTGACTGATCTGAAAGTAACTTTTACTCAAGCCGAGTATTATAGCCCGGTAAGTACACCTGCTGATTTCA
GACAGCTGACCCCTTATGTCTTCAGGCTGGCCTTGCAACAGTCAGGTGTGGACATTCTCGAACCGATGCTCTATTTTGAG
TTGCAGATACCCCAAGCGGCAAGTTCCAAAGCTATTACAGATTTGCAAAAAATGATGTCTGAGATTGAAGACATCAGTTG
CAATAATGAGTGGTGTCATATTAAAGGGAAAGTTCCATACAATACAAGTAAAGACTACGCCTCAGAAGTAAGTTCATACA
CTAAGGGCTTAGGCGTTTTTATGGTCAAGCCATGCGGGTATCAAATAACAAAAGGCGATTATTCTGATAATATCCGCATG
AACGAAAAAGATAAAATTTTATTCATGTTCCAAAAATCCAATGTCATCAAAATAATGGAGCGGTCAGGAAATTTCTATAA
GGCAATACAGTAG

>>MEG_7183|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETQ
ATGAATATTATAAATTTAGGAATTCTTGCTCACATTGATGCAGGAAAAACTTCCGTAACCGAGAATCTGCTGTTTGCCAG
TGGAGCAACGGAAAAGTGCGGCCGTGTGGATAATGGTGACACCATAACGGACTCTATGGATATAGAGAAACGTAGAGGAA
TTACTGTCCGGGCTTCTACGACATCTATTATCTGGAATGGAGTGAAATGCAATATCATTGACACTCCGGGACACATGGAT
TTTATTGCGGAAGTGGAGCGGACATTCAAAATGCTTGATGGAGCAGTCCTCATCTTATCCGCAAAGGAAGGCATACAAGC
GCAGACAAAGTTGCTGTTCAGTACTTTACAAAAGCTGCAAATCCCGACAATTATATTTATCAATAAGATTGACCGTGCCG
GTGTGAATTTGGAGCGTTTGTATATGGATATAAAAACAAATCTGTCGCAAGATGTCCTGTTTATGCAAACTGTTGTCGAT
GGATCGGTTTATCCGGTTTGCTCCCAAACATATATAAAGGAAGAATACAAAGAATTTGTATGCAACCATGACGACGATAT
ATTAGAACGATATTTGGCGGATAGCGAAATTTCACCGGCTGATTATTGGAATACGATAATCGCTCTTGTGGCAAAAGCCA
AAGTCTATCCGGTGCTACATGGATCAGCAATGTTCAATATCGGTATCAATGAGTTGTTGGACGCCATTACTTCTTTTATA
CTTCCTCCGGCATCAGTCTCAAACAGACTTTCAGCTTATCTCTATAAGATAGAGCATGACCCCAAAGGGCATAAAAGAAG
TTTTCTTAAAATAATTGACGGAAGTCTGAGACTTCGAGACGTTGTAAGAATCAACGATTCGGAAAAATTCATCAAGATTA
AAAATCTAAAGACTATTTATCAGGGCAGAGAGATAAATGTTGATGAAGTGGGTGCCAATGATATCGCGATTGTAGAAGAT
ATAGAAGATTTTCGAATCGGAGATTATTTAGGTGCTAAACCTTGTTTGATTCAAGGATTATCTCATCAGCATCCCGCTCT
CAAATGCTCCGTCCGGCCAAATAAGCCCGAAGAGAGAAGCAAGGTGATATCCGCTCTGAATACATTGTGGATTGAAGACC
CGTCTTTGTCCTTTTCCATAAACTCATATAGTGATGAATTGGAAATCTCGTTATATGGTTTGACCCAAAAGGAAATCATA
CAGACATTGCTGGAAGAACGATTTTCCGTAAAGGTCCATTTTGATGAGATCAAGACTATCTACAAAGAACGACCTATAAA
AAAGGTCAATAAGATTATTCAGATCGAAGTACCACCCAACCCTTACTGGGCCACAATAGGGCTGACTCTTGAACCCTTAC
CGTTAGGGGCAGGGTTGCAAATCGAAAGTGACATCTCCTATGGTTATCTGAACCATTCTTTTCAAAATGCCGTTTTTGAA
GGGATTCGTATGTCTTGCCAATCTGGTTTACATGGATGGGAAGTGACAGATCTGAAAGTAACTTTTACTCAAGCCGAGTA
TTATAGCCCGGTAAGTACACCTGCTGATTTCAGACAGCTGACCCCTTATGTCTTCAGGCTGGCTTTGCAACAGTCAGGTG
TGGACATTCTCGAACCGATGCTCTGTTTTGAGTTGCAGATACCCCAAGTAGCGAGTTCCAAAGCTATTACAGATTTGCAA
AAAATGATGTCTGAGATTGAAGACATCAGTTGTAATAATGAGTGGTGTCATATTAAAGGGAAAGTTCCATTAAATACAAG
TAAAGACTATGCCTCAGAAGTAAGTTCGTACACTAAGGGCTTAGGCATTTTTATGGTTAAGCCATGTGGGTATCAAATAA
CAAAAGACGGTTATTCTGATAATATCCGCATGAACGAAAAAGATAAACTTTTATTCATGTTCCAAAAATCAATGTCATTA
AAATAA

>>MEG_7184|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETQ
ATGAATATTATAAATTTAGGAATTCTTGCTCACATTGATGCAGGAAAAACTTCCGTAACCGAGAATCTGCTGTTTGCCAG
TGGAGCAACGGAAAAGTGCGGCTGTGTGGATAATGGTGACACCATAACGGACTCTATGGATATAGAGAAACGTAGAGGAA
TTACTGTTCGGGCTTCTACGACATCTATTATCTGGAATGGTGTGAAATGCAATATCATTGACACTCCGGGACACATGGAT
TTTATTGCGGAAGTGGAGCGGACATTCAAAATGCTTGATGGAGCAGTCCTCATCTTATCCGCAAAGGAAGGCATACAAGC
GCAGACAAAGTTGCTGTTCAATACTTTACAGAAGCTGCAAATCCCGACAATTATATTTATCAATAAGATTGACCGAGCCG
GTGTGAATTTGGAGCGTTTGTATCTGGATATAAAAGCAAATCTGTCTCAAGATGTCCTGTTTATGCAAAATGTTGTCGAT
GGATCGGTTTATCCGGTTTGCTCCCAAACATATATAAAGGAAGAATACAAAGAATTTGTATGCAACCATGACGACAATAT
ATTAGAACGATATTTGGCGGATAGCGAAATTTCACCGGCTGATTATTGGAATACGATAATCGCTCTTGTGGCAAAAGCCA
AAGTCTATCCGGTGCTACATGGATCAGCAATGTTCAATATCGGTATCAATGAGTTGTTGGACGCCATCACTTCTTTTATA
CTTCCTCCGGCATCGGTCTCAAACAGACTTTCATCTTATCTTTATAAGATAGAGCATGACCCCAAAGGACATAAAAGAAG
TTTTCTAAAAATAATTGACGGAAGTCTGAGACTTCGAGACGTTGTAAGAATCAACGATTCGGAAAAATTCATCAAGATTA
AAAATCTAAAAACTATCAATCAGGGCAGAGAGATAAATGTTGATGAAGTGGGCGCCAATGATATCGCGATTGTAGAGGAT
ATGGATGATTTTCGAATCGGAAATTATTTAGGTGCTGAACCTTGTTTGATTCAAGGATTATCGCATCAGCATCCCGCTCT
CAAATCCTCCGTCCGGCCAGACAGGCCCGAAGAGAGAAGCAAGGTGATATCCGCTCTGAATACATTGTGGATTGAAGACC
CGTCTTTGTCCTTTTCCATAAACTCATATAGTGATGAATTGGAAATCTCGTTATATGGTTTAACCCAAAAGGAAATCATA
CAGACATTGCTGGAAGAACGATTTTCCGTAAAGGTCCATTTTGATGAGATCAAGACTATATACAAAGAACGACCTGTAAA
AAAGGTCAATAAGATTATTCAGATCGAAGTGCCGCCCAACCCTTATTGGGCCACAATAGGGCTGACTCTTGAACCCTTAC
CGTTAGGGACAGGGTTGCAAATCGAAAGTGACATCTCCTATGGTTATCTGAACCATTCTTTTCAAAATGCCGTTTTTGAA
GGGATTCGTATGTCTTGCCAATCCGGGTTACATGGATGGGAAGTGACTGATCTGAAAGTAACTTTTACTCAAGCCGAGTA
TTATAGCCCGGTAAGTACACCTGCTGATTTCAGACAGCTGACCCCTTATGTCTTCAGGCTGGCCTTGCAACAGTCAGGTG
TGGACATTCTCGAACCGATGCTCTATTTTGAGTTGCAGATACCCCAAGCGGCAAGTTCCAAAGCTATTACAGATTTGCAA
AAAATGATGTCTGAGATTGAAGACATCAGTTGCAATAATGAGTGGTGTCATATTAAAGGGAAAGTTCCATTAAATACAAG
TAAAGACTATGCATCAGAAGTAAGTTCATACACTAAGGGCTTAGGCATTTTTATGGTTAAGCCATGCGGGTATCAAATAA
CAAAAGGCGGTTATTCTGATAATATCCGCATGAACGAAAAAGATAAACTTTTATTCATGTTCCAAAAATCAATGTCATCA
AAATAA