MEGAResFrom MEG, the Microbial Ecology Group

TETQ

The tetQ gene encodes a tetracycline ribosomal protection protein.

References

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>Tet|tetQ_1_L33696|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETQ
ATGAATATTATAAATTTAGGAATTCTTGCTCACATTGATGCAGGAAAAACTTCCGTAACCGAGAATCTGCTGTTTGCCAG
TGGAGCAACGGAAAAGTGCGGCCGTGTGGATAATGGTGACACCATAACGGACTCTATGGATATAGAGAAACGTAGAGGAA
TTACTGTCCGGGCTTCTACGACATCTATTATCTGGAATGGAGTGAAATGCAATATCATTGACACTCCGGGACACATGGAT
TTTATTGCGGAAGTGGAGCGGACATTCAAAATGCTTGATGGAGCAGTCCTCATCTTATCCGCAAAGGAAGGCATACAAGC
GCAGACAAAGTTGCTGTTCAGTACTTTACAAAAGCTGCAAATCCCGACAATTATATTTATCAATAAGATTGACCGTGCCG
GTGTGAATTTGGAGCGTTTGTATATGGATATAAAAACAAATCTGTCGCAAGATGTCCTGTTTATGCAAACTGTTGTCGAT
GGATCGGTTTATCCGGTTTGCTCCCAAACATATATAAAGGAAGAATACAAAGAATTTGTATGCAACCATGACGACGATAT
ATTAGAACGATATTTGGCGGATAGCGAAATTTCACCGGCTGATTATTGGAATACGATAATCGCTCTTGTGGCAAAAGCCA
AAGTCTATCCGGTGCTACATGGATCAGCAATGTTCAATATCGGTATCAATGAGTTGTTGGACGCCATTACTTCTTTTATA
CTTCCTCCGGCATCAGTCTCAAACAGACTTTCAGCTTATCTCTATAAGATAGAGCATGACCCCAAAGGGCATAAAAGAAG
TTTTCTTAAAATAATTGACGGAAGTCTGAGACTTCGAGACGTTGTAAGAATCAACGATTCGGAAAAATTCATCAAGATTA
AAAATCTAAAGACTATTTATCAGGGCAGAGAGATAAATGTTGATGAAGTGGGTGCCAATGATATCGCGATTGTAGAAGAT
ATAGAAGATTTTCGAATCGGAGATTATTTAGGTGCTAAACCTTGTTTGATTCAAGGATTATCTCATCAGCATCCCGCTCT
CAAATGCTCCGTCCGGCCAAATAAGCCCGAAGAGAGAAGCAAGGTGATATCCGCTCTGAATACATTGTGGATTGAAGACC
CGTCTTTGTCCTTTTCCATAAACTCATATAGTGATGAATTGGAAATCTCGTTATATGGTTTGACCCAAAAGGAAATCATA
CAGACATTGCTGGAAGAACGATTTTCCGTAAAGGTCCATTTTGATGAGATCAAGACTATCTACAAAGAACGACCTATAAA
AAAGGTCAATAAGATTATTCAGATCGAAGTACCACCCAACCCTTACTGGGCCACAATAGGGCTGACTCTTGAACCCTTAC
CGTTAGGGGCAGGGTTGCAAATCGAAAGTGACATCTCCTATGGTTATCTGAACCATTCTTTTCAAAATGCCGTTTTTGAA
GGGATTCGTATGTCTTGCCAATCTGGTTTACATGGATGGGAAGTGACAGATCTGAAAGTAACTTTTACTCAAGCCGAGTA
TTATAGCCCGGTAAGTACACCTGCTGATTTCAGACAGCTGACCCCTTATGTCTTCAGGCTGGCTTTGCAACAGTCAGGTG
TGGACATTCTCGAACCGATGCTCTGTTTTGAGTTGCAGATACCCCAAGTAGCGAGTTCCAAAGCTATTACAGATTTGCAA
AAAATGATGTCTGAGATTGAAGACATCAGTTGTAATAATGAGTGGTGTCATATTAAAGGGAAAGTTCCATTAAATACAAG
TAAAGACTATGCCTCAGAAGTAAGTTCGTACACTAAGGGCTTAGGCATTTTTATGGTTAAGCCATGTGGGTATCAAATAA
CAAAAGACGGTTATTCTGATAATATCCGCATGAACGAAAAAGATAAACTTTTATTCATGTTCCAAAAATCAATGTCATTA
AAATAA

>Tet|tetQ_3_U73497|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETQ
GTGCGTTTCGACAATGCATCTATTGTAGTATATTATTGCTTAATCCAAATGAATATTATAAATTTAGGAATTCTTGCTCA
CATTGATGCAGGAAAAACTTCCGTAACCGAGAATCTGCTGTTTGCCAGTGGAGCAACGGAAAAGTGCGGCCGTGTGGATA
ATGGTGACACCATAACAGACTCTATGGATATAGAGAAACGTAGAGGAATTACTGTTCGGGCTTCTACGACATCTATTATC
TGGAATGGAGTGAAATGCAATATCATTGACACTCCGGGACACATGGATTTTATTGCGGAAGTGGAGCGGACATTCAAAAT
GCTTGATGGAGCAGTCCTCATCTTATCCGCAAAGGAAGGCATACAAGCGCAAACAAAGTTGCTGTTCAATACTTTACAAA
AACTGCAAATCCCGACAATTATATTTATCAATAAAATTGACCGTGACGGTGTGAATTTAGAGCGTTTGTATCTGGATATA
AAAACAAATCTGTCTCAAGATGTCCTGTTTATGCAAACTGTTGTCGATGGATTGGTTTATCCGATTTGCTCCCAAACATA
TATAAAGGAAGAATACAAAGAATTTGTATGCAACCATGACGACAATATATTAGAACGATATTTGGCGGATAGCGAAATTT
CACCGGCTGATTATTGGAATACGATAATCGATCTTGTGGCAAAAGCCAAAGTCTATCCGGTACTACATGGATCAGCAATG
TTCAATATCGGTATCAATGAGTTGTTGGACGCCATCTCTTCTTTTATACTTCCTCCAGAATCAGTCTCAAACAGACTTTC
AGCTTATCTCTATAAGATAGAGCATGACCCCAAAGGACATAAAAGAAGTTTTCTAAAAATAATTGACGGAAGTCTGAGAC
TTCGAGACATTGTAAGAATCAACGATTCGGAAAAATTCATCAAGATTAAAAATCTAAAGACTATTTATCAGGGCAGAAAG
ATAAATGTTGATGAAGTGGGGGCCAATGATATCGCGATTGTAGAAGATATGGAAGATTTTCGAATCGGAGATTATTTAGG
TACTAAACCTTGTTTGATTCAAGGGTTATCTCATCAGCATCCCGCTCTCAAATCCTCCGTCCGGCCAGACAGGTCCGAAG
AGAGAAGCAAGGTGATATCCGCTCTGAATACATTGTGGATTGAAGACCCGTCTTTGTCCTTTTCCATAAACTCATATAGT
GATGAATTGGAAATCTCGTTATATGGTTTGACACAAAAGGAAATCATACAGACATTGCTGGAAGAACGATTTTCCGTAAA
GGTCCATTTTGATGAGATCAAGACTATCTACAAAGAACGACCTGTAAAAAAGGTCAATAAGATTATTCAGATCGAAGTGC
CACCCAACCCTTACTGGGCCACAATAGGGCTGACGCTTGAACCCTTGCCGTTAGGGACAGGGTTGCAAATCGAAAGTGAC
ATCTCCTATGGTTATCTGAACCATTCTTTTCAAAATGCCGTTTTTGAAGGGATTCGTATGTCTTGCCAATCTGGTTTACA
TGGATGGGAAGTGACTGATCTGAAAGTAACTTTTACTCAAGCCGAGTATTATAGCCCGGTAAGTACACCTGCTGATTTCA
GACAGCTGACCCCTTATGTCTTCAGGCTGGCCTTGCAACAGTCAGGTGTGGACATTCTCGAACCGATGCTCTATTTTGAG
TTGCAGATACCCCAAGCGGCAAGTTCCAAAGCTATTACAGATTTGCAAAAAATGATGTCTGAGATTGAAGACATCAGTTG
CAATAATGAGTGGTGTCATATTAAAGGGAAAGTTCCATACAATACAAGTAAAGACTACGCCTCAGAAGTAAGTTCATACA
CTAAGGGCTTAGGCGTTTTTATGGTCAAGCCATGCGGGTATCAAATAACAAAAGGCGATTATTCTGATAATATCCGCATG
AACGAAAAAGATAAAATTTTATTCATGTTCCAAAAATCCAATGTCATCAAAATAATGGAGCGGTCAGGAAATTTCTATAA
GGCAATACAGTAG

>Tmt|tetQ_2_X58717|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETQ
ATGAATATTATAAATTTAGGAATTCTTGCTCACATTGATGCAGGAAAAACTTCCGTAACCGAGAATCTGCTGTTTGCCAG
TGGAGCAACGGAAAAGTGCGGCTGTGTGGATAATGGTGACACCATAACGGACTCTATGGATATAGAGAAACGTAGAGGAA
TTACTGTTCGGGCTTCTACGACATCTATTATCTGGAATGGTGTGAAATGCAATATCATTGACACTCCGGGACACATGGAT
TTTATTGCGGAAGTGGAGCGGACATTCAAAATGCTTGATGGAGCAGTCCTCATCTTATCCGCAAAGGAAGGCATACAAGC
GCAGACAAAGTTGCTGTTCAATACTTTACAGAAGCTGCAAATCCCGACAATTATATTTATCAATAAGATTGACCGAGCCG
GTGTGAATTTGGAGCGTTTGTATCTGGATATAAAAGCAAATCTGTCTCAAGATGTCCTGTTTATGCAAAATGTTGTCGAT
GGATCGGTTTATCCGGTTTGCTCCCAAACATATATAAAGGAAGAATACAAAGAATTTGTATGCAACCATGACGACAATAT
ATTAGAACGATATTTGGCGGATAGCGAAATTTCACCGGCTGATTATTGGAATACGATAATCGCTCTTGTGGCAAAAGCCA
AAGTCTATCCGGTGCTACATGGATCAGCAATGTTCAATATCGGTATCAATGAGTTGTTGGACGCCATCACTTCTTTTATA
CTTCCTCCGGCATCGGTCTCAAACAGACTTTCATCTTATCTTTATAAGATAGAGCATGACCCCAAAGGACATAAAAGAAG
TTTTCTAAAAATAATTGACGGAAGTCTGAGACTTCGAGACGTTGTAAGAATCAACGATTCGGAAAAATTCATCAAGATTA
AAAATCTAAAAACTATCAATCAGGGCAGAGAGATAAATGTTGATGAAGTGGGCGCCAATGATATCGCGATTGTAGAGGAT
ATGGATGATTTTCGAATCGGAAATTATTTAGGTGCTGAACCTTGTTTGATTCAAGGATTATCGCATCAGCATCCCGCTCT
CAAATCCTCCGTCCGGCCAGACAGGCCCGAAGAGAGAAGCAAGGTGATATCCGCTCTGAATACATTGTGGATTGAAGACC
CGTCTTTGTCCTTTTCCATAAACTCATATAGTGATGAATTGGAAATCTCGTTATATGGTTTAACCCAAAAGGAAATCATA
CAGACATTGCTGGAAGAACGATTTTCCGTAAAGGTCCATTTTGATGAGATCAAGACTATATACAAAGAACGACCTGTAAA
AAAGGTCAATAAGATTATTCAGATCGAAGTGCCGCCCAACCCTTATTGGGCCACAATAGGGCTGACTCTTGAACCCTTAC
CGTTAGGGACAGGGTTGCAAATCGAAAGTGACATCTCCTATGGTTATCTGAACCATTCTTTTCAAAATGCCGTTTTTGAA
GGGATTCGTATGTCTTGCCAATCCGGGTTACATGGATGGGAAGTGACTGATCTGAAAGTAACTTTTACTCAAGCCGAGTA
TTATAGCCCGGTAAGTACACCTGCTGATTTCAGACAGCTGACCCCTTATGTCTTCAGGCTGGCCTTGCAACAGTCAGGTG
TGGACATTCTCGAACCGATGCTCTATTTTGAGTTGCAGATACCCCAAGCGGCAAGTTCCAAAGCTATTACAGATTTGCAA
AAAATGATGTCTGAGATTGAAGACATCAGTTGCAATAATGAGTGGTGTCATATTAAAGGGAAAGTTCCATTAAATACAAG
TAAAGACTATGCATCAGAAGTAAGTTCATACACTAAGGGCTTAGGCATTTTTATGGTTAAGCCATGCGGGTATCAAATAA
CAAAAGGCGGTTATTCTGATAATATCCGCATGAACGAAAAAGATAAACTTTTATTCATGTTCCAAAAATCAATGTCATCA
AAATAA

>Tet|TetQ|Z21523|362-2287|1926|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETQ
GTGCGTTTCGACAATGCATCTATTGTAGTATATTATTGCTTAATCCAAATGAATATTATAAATTTAGGAATTCTTGCTCA
CATTGATGCAGGAAAAACTTCCGTAACCGAGAATCTGCTGTTTGCCAGTGGAGCAACGGAAAAGTGCGGCCGTGTGGATA
ATGGTGACACCATAACAGACTCTATGGATATAGAGAAACGTAGAGGAATTACTGTTCGGGCTTCTACGACATCTATTATC
TGGAATGGAGTGAAATGCAATATCATTGACACTCCGGGACACATGGATTTTATTGCGGAAGTGGAGCGGACATTCAAAAT
GCTTGATGGAGCAGTCCTCATCTTATCCGCAAAGGAAGGCATACAAGCGCAAACAAAGTTGCTGTTCAATACTTTACAAA
AACTGCAAATCCCGACAATTATATTTATCAATAAAATTGACCGTGACGGTGTGAATTTAGAGCGTTTGTATCTGGATATA
AAAACAAATCTGTCTCAAGATGTCCTGTTTATGCAAACTGTTGTCGATGGATTGGTTTATCCGATTTGCTCCCAAACATA
TATAAAGGAAGAATACAAAGAATTTGTATGCAACCATGACGACAATATATTAGAACGATATTTGGCGGATAGCGAAATTT
CACCGGCTGATTATTGGAATACGATAATCGATCTTGTGGCAAAAGCCAAAGTCTATCCGGTACTACATGGATCAGCAATG
TTCAATATCGGTATCAATGAGTTGTTGGACGCCATCTCTTCTTTTATACTTCCTCCAGAATCAGTCTCAAACAGACTTTC
AGCTTATCTCTATAAGATAGAGCATGACCCCAAAGGACATAAAAGAAGTTTTCTAAAAATAATTGACGGAAGTCTGAGAC
TTCGAGACATTGTAAGAATCAACGATTCGGAAAAATTCATCAAGATTAAAAATCTAAAGACTATTTATCAGGGCAGAGAG
ATAAATGTTGATGAAGTGGGGGCCAATGATATCGCGATTGTAGAAGATATGGAAGATTTTCGAATCGGAGATTATTTAGG
TACTAAACCTTGTTTGATTCAAGGGTTATCTCATCAGCATCCCGCTCTCAAATCCTCCGTCCGGCCAGACAGGTCCGAAG
AGAGAAGCAAGGTGATATCCGCTCTGAATACATTGTGGATTGAAGACCCGTCTTTGTCCTTTTCCATAAACTCATATAGT
GATGAATTGGAAATCTCGTTATATGGTTTGACACAAAAGGAAATCATACAGACATTGCTGGAAGAACGATTTTCCGTAAA
GGTCCATTTTGATGAGATCAAGACTATCTACAAAGAACGACCTGTAAAAAAGGTCAATAAGATTATTCAGATCGAAGTGC
CACCCAACCCTTACTGGGCCACAATAGGGCTGACGCTTGAACCCTTGCCGTTAGGGACAGGGTTGCAAATCGAAAGTGAC
ATCTCCTATGGTTATCTGAACCATTCTTTTCAAAATGCCGTTTTTGAAGGGATTCGTATGTCTTGCCAATCTGGTTTACA
TGGATGGGAAGTGACTGATCTGAAAGTAACTTTTACTCAAGCCGAGTATTATAGCCCGGTAAGTACACCTGCTGATTTCA
GACAGCTGACCCCTTATGTCTTCAGGCTGGCCTTGCAACAGTCAGGTGTGGACATTCTCGAACCGATGCTCTATTTTGAG
TTGCAGATACCCCAAGCGGCAAGTTCCAAAGCTATTACAGATTTGCAAAAAATGATGTCTGAGATTGAAGACATCAGTTG
CAATAATGAGTGGTGTCATATTAAAGGGAAAGTTCCATTAAATACAAGTAAAGACTACGCCTCAGAAGTAAGTTCATACA
CTAAGGGCTTAGGCGTTTTTATGGTCAAGCCATGCGGGTATCAAATAACAAAAGGCGATTATTCTGATAATATCCGCATG
AACGAAAAAGATAAACTTTTATTCATGTTCCAAAAATCAATGTCATCAAAATAA