MEGAResFrom MEG, the Microbial Ecology Group

TETO

The tetO gene encodes a tetracycline ribosomal protection protein.

References

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>Tet|TetO|M18896|207-2126|1920|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAAGTATACCGTTCTTTATCCGTATTAGACGGAGCAGTATTATTAGTTTCTGCAAAGGATGGCATACAGGC
ACAGACCCGTATACTGTTTCATGCACTACAGATAATGAAGATTCCGACAATTTTTTTCATCAATAAAATTGACCAAGAGG
GGATTGATTTGCCAATGGTATATCGGGAAATGAAAGCAAAGCTTTCTTCGGAAATTATAGTGAAGCAAAAGGTTGGGCAG
CATCCCCATATAAATGTAACGGACAATGACGATATGGAACAGTGGGATGCGGTAATTATGGGAAACGATGAACTATTAGA
GAAATATATGTCAGGGAAACCGTTTAAAATGTCAGAACTGGAACAGGAAGAAAACAGGAGATTCCAAAACGGAACGTTAT
TTCCCGTTTATCACGGAAGCGCTAAAAACAATCTGGGGACTCGGCAGCTTATAGAAGTAATTGCCAGTAAATTTTATTCA
TCAACGCCTGAAGGTCAATCTGAACTATGCGGGCAGGTTTTTAAGATTGAATATTCAGAGAAAAGGCGGCGTTTTGTTTA
TGTGCGTATATATAGCGGAACATTGCATTTGAGGGATGTTATTAGAATATCTGAAAAAGAGAAAATAAAAATCACAGAGA
TGTATGTTCCGACAAACGGTGAATTATATTCATCCGATACAGCCTGCTCTGGTGATATTGTAATTTTACCAAATGATGTT
TTGCAGCTAAACAGTATTTTGGGGAACGAAATACTGTTGCCGCAGAGAAAATTTATTGAAAATCCTCTCCCTATGATCCA
AACAACGATTGCAGTAAAGAAATCTGAACAGCGGGAAATATTGCTTGGGGCACTTACAGAAATTTCAGATTGCGACCCTC
TTTTAAAATATTATGTGGATACTACAACGCATGAGATTATACTTTCTTTTTTGGGGAATGTGCAGATGGAAGTCATTTGT
GCCATCCTTGAGGAAAAATATCATGTGGAGGCAGAAATAAAAGAGCCTACTGTTATATATATGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTTATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>Tet|tetO_2_M20925|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAGAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACCAGGGAGCGTAGATAAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAAGTATACCGTTCTTTATCCGTATTAGACGGAGCAGTATTATTAGTTTCTGCAAAGGATGGCATACAGGC
ACAGACCCGTATACTGTTTCATGCACTACAGACAATGAAGATTCCGACAATTTTTTTCATCAATAAAATTGACCAAGAGG
GGATTGATTTGCCAATGGTATATCGAGAAATGAAAGCAAAGCTTTCTTCGGAAATTATAGTGAAGCAAAAGGTTGGGCAG
CATCCCCATATAAATGTAACAGACAATGACGATATGGAACAGTGGGATACGGTAATTATGGGAAACGATGAACTATTAGA
GAAATATATGTCAGGGAAACCGTTTAAAATGTCAGAACTGGAACAGGAAGAAAACAGGAGATTCCAAAACGGAACGTTAT
TTCCCGTTTATCACGGAAGCGCTAAAAACAATCTGGGGATTCGGCAGCTTATAGAAGTGATTGCCAGTAAATTTTATTCA
TCAACGCCTGAAGGTCAATCTGAACTATGCGGGCAGGTTTTTAAGATTGAATATTCAGAGAAAAGGCGGCGTTTTGTTTA
TGTGCGTATATATAGCGGAACATTGCATTTGAGGGATGTTATTAGAATATCTGAAAAAGAGAAAATAAAAATCACAGAGA
TGTGTGTTCCGACAAACGGTGAATTATATTCATCCGATACAGCCTGCTCTGGTGATATTGTAATTTTACCAAATGATGTT
TTGCAGCTAAACAGTATTTTGGGGAACGAAATACTGTTGCCGCAGAGAAAATTTATTGAAAATCCTCTCCCTATGCTCCA
AACAACGATTGCAGTAAAGAAATCTGAACAGCGGGAAATATTGCTTGGGGCACTTACAGAAATTTCAGATGGCGACCCTC
TTTTAAAATATTATGTGGATACTACAACGCATGAGATTATACTTTCTTTTTTGGGGAATGTGCAGATGGAAGTCATTTGT
GCCATCCTTGAGGAAAAATATCATGTGGAGGCAGAAATAAAAGAGCCTACTGTTATATATATGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTTATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>Tet|tetO_3_Y07780|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAGAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACCAGGGAGCGTAGATAAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAAGTATACCGTTCTTTATCCGTATTAGACGGAGCAGTATTATTAGTTTCTGCAAAGGATGGCATACAGGC
ACAGACCCGTATACTGTTTCATGCACTACAGACAATGAAGATTCCGACAATTTTTTTCATCAATAAAATTGACCAAGAGG
GGATTGATTTGCCAATGGTATATCAAGAAATGAAAGCAAAGCTTTCTTCGGAAATTATAGTGAAGCAAAAGGTTGGGCAG
CATCCCCATATAAATGTAACGGACAATGACGATATGGAACAGTGGGATGCGGTAATTATGGGAAACGATGAACTATTAGA
GAAATATATGTCAGGGAAACCGTTTAAAATGTCAGAACTGGAACAGGAAGAAAACAGGAGATTCCAAAACGGAACGTTAT
TTCCCGTTTATCACGGAAGTGCTAAAAACAATCTGGGGATTCGGCAGCTTATAGAAGTGATTGCCAGTAAGTTTTATTCA
TCAACGCCTGAAGGTCAATCTGAACTATGCGGGCAGGTTTTTAAGATTGAATATTCAGAGAAAAGGCGGCGTTTTGTTTA
TGTGCGTATATATAGCGGAACATTGCATTTGAGGGATGTTATTAAAATATCTGAAAAAGAGAAAATAAAAATCACAGAGA
TGTGTGTTCCGACAAACGGTGAATTATATTCATCCGATACAGCCTGCTCTGGTGATATTGTAATTTTACCAAATGATGTT
TTGCAGCTAAACAGTATTTTGGGGAACGAAATGCTGTTGCCGCAGAGAAAATTTATTGAAAATCCTCTCCCTATGCTCCA
AACAACGATTGCAGTAAAGAAATCTGAACAGCGGGAAATATTGCTTGGGGCACTTACAGAAATTTCAGATGGCGACCCTC
TTTTAAAATATTATGTGGATACTACAACGCATGAGATTATACTTTCTTTTTTGGGGAATGTGCAGATGGAAGTCATTTGT
GCCATCCTTGAGGAAAAATACCATGTGGAGGCAGAAATAAAAGAGCCTACTGTTATATATATGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAACCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCCCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGGTAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCCAGATGTATTCA
AGAATACAGGAACGATTTAACTTATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA