MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TETO

The tetO gene encodes a tetracycline ribosomal protection protein.

References

  • http://aac.asm.org/content/47/12/3675

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>>MEG_7149|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
atgaaaataattaacttaggcattctgggtcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaagtataccgttctttatccgtattagacggagcagtattattagtttctgcaaaggatggcatacaggc
acagacccgtatactgtttcatgcactacagataatgaagattccgacaatttttttcatcaataaaattgaccaagagg
ggattgatttgccaatggtatatcgggaaatgaaagcaaagctttcttcggaaattatagtgaagcaaaaggttgggcag
catccccatataaatgtaacggacaatgacgatatggaacagtgggatgcggtaattatgggaaacgatgaactattaga
gaaatatatgtcagggaaaccgtttaaaatgtcagaactggaacaggaagaaaacaggagattccaaaacggaacgttat
ttcccgtttatcacggaagcgctaaaaacaatctggggattcggcagcttatagaagtaattgccagtaaattttattca
tcaacgcctgaaggtcaatctgaactatgcgggcaggtttttaagattgaatattcagagaaaaggcggcgttttgttta
tgtgcgtatatatagcggaacattgcatttgagggatgttattagaatatctgaaaaagagaaaataaaaatcacagaga
tgtatgttccgacaaacggtgaattatattcatccgatacagcctgctctggtgatattgtaattttaccaaatgatgtt
ttgcagctaaacagtattttggggaacgaaatactgttgccgcagagaaaatttattgaaaatcctctccctatgctcca
aacaacgattgcagtaaagaaatctgaacagcgggaaatattgcttggggcacttacagaaatttcagatggcgaccctc
ttttaaaatattatgtggatactacaacgcatgagattatactttcttttttggggaatgtgcagatggaagtcatttgt
gccatccttgaggaaaaatatcatgtggaggcagaaataaaagagcctactgttatatatatggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgccaaatcctttctgggcttctgtcgggttgtccatagagccgctcccta
ttggaagcggagtgcagtatgaaagcagagtttcacttggatatttaaatcaatcgttccaaaatgcggttatggagggg
gttctttatggctgcgagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaacttatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7150|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaagaacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggtcatatggat
tttttggcggaagtataccgttctttatccgttttagacggagcagtattattagtttctgcaaaggatggcatacaggc
acagacccgtatactgtttcatgcactacagacaatgaagattccgacaatcttttttatcaataaaattgaccaagagg
ggattgatttgccaatggtatatcgagaaatgaaagcaaagctttcttcggaaattatagtgaagcaaaaggttgggcag
catccccatataaatgtaacggacaatgacgatatggaacagtgggatgcggtaattatgggaaacgatgaactattaga
gaaatatatgtcagggaaaccgtttaaaatgtcagaactggaacaggaagaaaacaggagattccaaaacggaacgttat
ttcccgtttatcacggaagcgctaaaaacaatctggggattcggcagcttatagaagtgattgccagtaaattttattca
tcaacgcctgaaggtcaatctgaactatgcgggcaggtttttaagattgaatattcagagaaaaggcggcgttttgttta
tgtgcgtatatatagcggaacattgcatttgagggatgttattagaatatctgaaaaagagaaaataaaaatcacagaga
tgtgtgttccgacaaacggtgaattatattcatccgatatagcctgctctggtgatattgtaattttaccaaatgatgtt
ttgcagctaaacagtattttggggaacgaaatgctgttgccgcagagaaaatttattgaaaatcctctccctatgctcca
aacaacgattgcagtaaagaaatctgaacagcgggaaatattgcttggggcacttacagaaatttcagatggcgaccctc
ttttaaaatattatgtggatactacaacgcatgagattatactttcttttttggggaaagtgcagatggaagtcatttgt
gccatccttgaggaaaaatatcatgtggaggcagaaataaaagagcctactgttatatatatggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgccaaatcctttctgggcttctgtcgggttgtccatagagccgctcccta
ttggaagcggagtgcagtatgaaagcagagtttcacttggatatttaaatcaatcgttccaaaatgcggttatggagggg
gttctttatggctgcgagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaacttatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7151|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaagtataccgttctttatccgcattagacggagcagtattattagtttctgcaaaggatggcatacaggc
acagacccgtatactgtttcatgcactacagataatgaagattccgacaatttttttcatcaataaaattgaccaagagg
ggattgatttgccaatggtatatcgggaaatgaaagcaaagctttcttcggaaattatagtgaagcaaaaggttgggcag
catccccatataaatgtaacggacaatgacgatatggaacagtgggatgcggtaattatgggaaacgatgaactattaga
gaaatatatgtcagggaaaccgtttaaaatgtcagaactggaacaggaagaaaacaggagattccaaaacggaacgttat
ttcccgtttatcacggaagcgctaaaaacaatctggggattcggcagcttatagaagtaattgccagtaaattttattca
tcaacgcctgaaggtcaatctgaactatgcgggcaggtttttaagattgaatattcagagaaaaggcggcgttttgttta
tgtgcgtatatatagcggaacattgcatttgagggatgttattagaatatctgaaaaagagaaaataaaaatcacagaga
tgtatgttccgacaaacggtgaattatattcatccgatacagcctgctctggtgatattgtaattttaccaaatgatgtt
ttgcagctaaacagtattttggggaacgaaatactgttgccgcagagaaaatttattgaaaatcctctccctatgatcca
aacaacgattgcagtaaagaaatctgaacagcgggaaatattgcttggggcacttacagaaatttcagattgcgaccctc
ttttaaaatattatgtggatactacaacgcatgagattatactttcttttttggggaatgtgcagatggaagtcatttgt
gccatccttgaggaaaaatatcatgtggaggcagaaataaaagagcctactgttatatatatggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgccaaatcctttctgggcttctgtcgggttgtccatagagccgctcccta
ttggaagcggagtgcagtatgaaagcagagtttcacttggatatttaaatcaatcgttccaaaatgcggttatggagggg
gttctttatggctgcgagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaacttatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7152|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaagtataccgttctttatccgcattagacggagcagtattattagtttctgcaaaggatggcatacaggc
acagacccgtatactgtttcatgcactacagataatgaagattccgacaatttttttcatcaataaaattgaccaagagg
ggattgatttgccaatggtatatcgggaaatgaaagcaaagctttcttcggaaattatagtgaagcaaaaggttgggcag
catccccatataaatgtaacggacaatgacgatatggaacagtgggatgcggtaattatgggaaacgatgaactattaga
gaaatatatgtcagggaaaccgtttaaaatgtcagaactggaacaggaagaaaacaggagattccaaaacggaacgttat
ttcccgtttatcacggaagcgctaaaaacaatctggggattcggcagcttatagaagtaattgccagtaaattttattca
tcaacgcctgaaggtcaatctgaactatgcgggcgggtttttaagattgaatattcaaagaaaaggcggcgttttgttta
tgtgcgtatatatagcggaacattgcatttgagggatgttattagaatatctgaaaaagagaaaataaaaatcacagaga
tgtgtgttccgacaaacggtgaattatattcatccgatacagcctgctctggtgatattgtaattttaccaaatgatgtt
ttgcagctaaacagtattttggggaacgaaatactgttgccgcagagaaaatttattgaaaatcctctccctatgctcca
aacaacgattgcagtaaagaaatctgaacagcgggaaatattgcttggggcacttacagaaatttcagatggcgaccctc
ttttaaaatattatgtggatactacaacgcatgagattatactttcttttttggggaatgtgcagatggaagtcatttgt
gccatccttgaggaaaaatatcatgtggaggcagaaataaaagagcctactgttatatatatggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgccaaatcctttctgggcttctgtcgggttgtccatagagccgctcccta
ttggaagcggagtgcagtatgaaagcagagtttcacttggatatttaaatcaatcgttccaaaatgcggttatggagggg
gttctttatggctgcgagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaacttgtttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7153|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaagtataccgttctttatccgtattagacggagcagtattattagtttctgcaaaggatggcatacaggc
acagacccgtatactgtttcatgcactacagataatgaagattccgacaatttttttcatcaataaaattgaccaagagg
ggattgatttgccaatggtatatcgggaaatgaaagcaaagctttcttcggaaattatagtgaagcaaaaggttgggcag
catccccatataaatgtaacggacaatgacgatatggaacagtgggatgcggtaattatgggaaacgatgaactattaga
gaaatatatgtcagggaaaccgtttaaaatgtcagaactggaacaggaagaaaacaggagattccaaaacggaacgttat
ttcccgtttatcacggaagcgctaaaaacaatctggggattcggcagcttatagaagtaattgccagtaaattttattca
tcaacgcctgaaggtcaatctgaactatgcgggcaggtttttaagattgaatattcagagaaaaggcggcgttttgttta
tgtgcgtatatatagcggaacattgcatttgagggatgttattagaatatctgaaaaagagaaaataaaaatcacagaga
tgtatgttccgacaaacggtgaattatattcatccgatacagcctgctctggtgatattgtaattttaccaaatgatgtt
ttgcagctaaacagtattttggggaacgaaatactgttgccgcagagaaaatttattgaaaatcctctccctatgatcca
aacaacgattgcagtaaagaaatctgaacagcgggaaatattgcttggggcacttacagaaatttcagattgcgaccctc
ttttaaaatattatgtggatactacaacgcatgagattatactttcttttttggggaatgtgcagatggaagtcatttgt
gccatccttgaggaaaaatatcatgtggaggcagaaataaaagagcctactgttatatatatggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgccaaatcctttctgggcttctgtcgggttgtccatagagccgctcccta
ttggaagcggagtgcagtatgaaagcagagtttcacttggatatttaaatcaatcgttccaaaatgcggttatggagggg
gttctttatggctgcgagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaacttatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7154|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaagtataccgttctttatccgtattagacggagcagtattattagtttctgcaaaggatggcatacaggc
acagacccgtatactgtttcatgcactacagataatgaagattccgacaatttttttcatcaataaaattgaccaagagg
ggattgatttgccaatggtatatcgggaaatgaaagcaaagctttcttcggaaattatagtgaagcaaaaggttgggcag
catccccatataaatgtaacggacaatgacgatatggaacagtgggatgcggtaattatgggaaacgatgaactattaga
gaaatatatgtcagggaaaccgtttaaaatgtcagaactggaacaggaagaaaacaggagattccaaaacggaacgttat
ttcccgtttatcacggaagcgctaaaaacaatctggggattcggcagcttatagaagtaattgccagtaaattttattca
tcaacgcctgaaggtcaatctgaactatgcgggcaggtttttaagattgaatattcagagaaaaggcggcgttttgttta
tgtgcgtatatatagcggaacattgcatttgagggatgttattagaatatctgaaaaagagaaaataaaaatcacagaga
tgtgtgttccgacaaacggtgaattatattcatccgatacagcctgctctggtgatattgtaattttaccaaatgatgtt
ttgcagctaaacagtattttggggaacgaaatactgttgccgcagagaaaatttattgaaaatcctctccctatgctcca
aacaacgattgcagtaaagaaatctgaacagcgggaaatattgcttggggcacttacagaaatttcagatggcgaccctc
ttttaaaatattatgtggatactacaacgcatgagattatactttcttttttggggaatttgcagatggaagtcatttgt
gccatccttgaggaaaaatatcatgtggaggcagaaataaaagagcctactgttatatatatggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgccaaatcctttctgggcttctgtcgggttgtccatagagccgctcccta
ttggaagcggagtgcagtatgaaagcagagtttcacttggatatttaaatcaatcgttccaaaatgcggttatggagggg
gttctttatggctgcgagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaacttatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7155|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaagtataccgttctttatccgtattagacggagcagtattattagtttctgcaaaggatggcatacaggc
acagacccgtatactgtttcatgcactacagataatgaagattccgacaatttttttcatcaataaaattgaccaagagg
ggattgatttgccaatggtatatcgggaaatgaaagcaaagctttcttcggaaattatagtgaagcaaaaggttgggcag
catccccatataaatgtaacggacaatgacgatatggaacagtgggatgcggtaattatgggaaacgatgaactattaga
gaaatatatgtcagggaaaccgtttaaaatgtcagaactggaacaggaagaaaacaggagattccaaaacggaacgttat
ttcccgtttatcacggaagcgctaaaaacaatctggggattcggcagcttatagaagtaattgccagtaaattttattca
tcaacgcctgaaggtcaatctgaactatgcgggcaggtttttaagattgaatattcggaagaaagacaacgtcttgcata
tgtacgcctttatggcggaatcctgcatttgcgggattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaattgataaggcttattccggggaaattgttattttgcaaaatgagttt
ttgaagctaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcctctccctatgctcca
aacaactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctacaatattatgtggatactacaacgcatgagattatactttcttttttggggaatgtgcagatggaagtcatttgt
gccatccttgaggaaaaatatcatgtggaggcagaaataaaagagcctactgttatatatatggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgccaaatcctttctgggcttctgtcgggttgtccatagagccgctcccta
ttggaagcggagtgcagtatgaaagcagagtttcacttggatatttaaatcaatcgttccaaaatgcggttatggagggg
gttctttatggctgcgagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaacttgtttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7156|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggaaagtttattgtataccag
tggtgcaattgcagaactagggagcgtagatgaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaagtataccgttctttatccgtattagacggagcagtattattagtttctgcaaaggatggcatacaggc
acagacccgtatactgtttcatgcactacagataatgaagattccgacaatttttttcatcaataaaattgaccaagagg
ggattgatttgccaatggtatatcgggaaatgaaagcaaagctttcttcggaaattatagtgaagcaaaaggttgggcag
catccccatatgaatgtaacggacaatgacgatatggaacagtgggatgcggtaattatgggagacgatgaactattaga
gaaatatatgtcagggaaaccgtttaaaatgtcagaactggaacaggaagaaaacaggagattccaaaacggaacgttat
ttcccgtttatcacggaagcgctaaaaacaatctggggattcggcagcttatagaagtaattgccagtaaattttattca
tcaacgcctgaaggtcaatctgaactatgcgggcaggtttttaagattgaatattcagagaaaaggcggcgttttgttta
tgtgcgtatatatagcggaacattgcatttgagggatgttattagaatatctgaaaaagagaaaataaaaatcacagaga
tgtgtgttccgacaaacggtgaattatattcatccgatacagcctgctctggtgatattgtaattttaccaaatgatgtt
ttgcagctaaacagtattttggggaacgaaatactgttgccgcagagaaaatttattgaaaatcctctccctatgctcca
aacaacgattgcagtaaagaaatctgaacagcgggaaatattgcttggggcacttacagaaatttcagatggcgaccctc
ttttaaaatattatgtggatactacaacgcatgagattatactttcttttttggggaatgtgcagatggaagtcatttgt
gccatccttgaggaaaaatatcatgtggaggcagaaataaaagagcctactgttatatatatggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgccaaatcctttctgggcttctgtcgggttgtccatagagccgctcccta
ttggaagcggagtgcagtatgaaagcagagtttcacttggatatttaaatcaatcgttccaaaatgcggttatggagggg
gttctttatggctgcgagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaacttatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7157|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggagagtttattgtataccag
tggtgcaattgcagaaccagggagcgtagataaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaagtataccgttctttatccgtattagacggagcagtattattagtttctgcaaaggatggcatacaggc
acagacccgtatactgtttcatgcactacagacaatgaagattccgacaatttttttcatcaataaaattgaccaagagg
ggattgatttgccaatggtatatcaagaaatgaaagcaaagctttcttcggaaattatagtgaagcaaaaggttgggcag
catccccatataaatgtaacggacaatgacgatatggaacagtgggatgcggtaattatgggaaacgatgaactattaga
gaaatatatgtcagggaaaccgtttaaaatgtcagaactggaacaggaagaaaacaggaaattccaaaccggaacgttat
ttcccgtttatcacggaagtgctaaaaacaatctggggattcggcagcttaaaaaagggattgccagtaagttttattca
tcaacgcctgaaggtcaatctgaactatgcgggcaggtttttaagattgaatattcagagaaaaggcggcgttttgttta
tgtgcgtatatatagcggaacattgcatttgagggatgttattaaaatatctgaaaaagagaaaataaaaatcacagaga
tgtgtgttccgacaaacggtgaattatattcatccgatacagcctgctctggtgatattgtaattttaccaaatgatgtt
ttgcagctaaacagtattttggggaacgaaatgctgttgccgcagagaaaatttattgaaaatcctctccctatgctcca
aacaacgattgcagtaaagaaatctgaacagcgggaaatattgcttggggcacttacagaaatttcagatggcgaccctc
ttttaaaatattatgtggatactacaacgcatgagattatactttcttttttggggaatgtgcagatggaagtcatttgt
gccatccttgaggaaaaataccatgtggaggcagaaataaaagagcctactgttatatatatggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgccaaatcctttctgggcttctgtcgggttgtccatagagccgctcccta
ttggaagcggagtgcagtatgaaagcagagtttcacttggatatttaaaccaatcgttccaaaatgcggttatggagggg
gttctttatggctgcgagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgccccaagg
tattgtgcagatattgtaagtactcaggtaaagaatgacgaggtcattctgaaaggagaaatccctgccagatgtattca
agaatacaggaacgatttaacttatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7158|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggagagtttattgtataccag
tggtgcaattgcagaaccagggagcgtagataaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaagtataccgttctttatccgtattagacggagcagtattattagtttctgcaaaggatggcatacaggc
acagacccgtatactgtttcatgcactacagacaatgaagattccgacaatttttttcatcaataaaattgaccaagagg
ggattgatttgccaatggtatatcaagaaatgaaagcaaagctttcttcggaaattatagtgaagcaaaaggttgggcag
catccccatataaatgtaacggacaatgacgatatggaacagtgggatgcggtaattatgggaaacgatgaactattaga
gaaatatatgtcagggaaaccgtttaaaatgtcagaactggaacaggaagaaaacaggagattccaaaacggaacgttat
ttcccgtttatcacggaagtgctaaaaacaatctggggattcggcagcttatagaagtgattgccagtaagttttattca
tcaacgcctgaaggtcaatctgaactatgcgggcaggtttttaagattgaatattcagagaaaaggcggcgttttgttta
tgtgcgtatatatagcggaacattgcatttgagggatgttattaaaatatctgaaaaagagaaaataaaaatcacagaga
tgtgtgttccgacaaacggtgaattatattcatccgatacagcctgctctggtgatattgtaattttaccaaatgatgtt
ttgcagctaaacagtattttggggaacgaaatgctgttgccgcagagaaaatttattgaaaatcctctccctatgctcca
aacaacgattgcagtaaagaaatctgaacagcgggaaatattgcttggggcacttacagaaatttcagatggcgaccctc
ttttaaaatattatgtggatactacaacgcatgagattatactttcttttttggggaatgtgcagatggaagtcatttgt
gccatccttgaggaaaaatatcatgtggaggcagaaacaaaagagtctactgttatatatatggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgccaaatcctttctgggcttctgtcgggttgtccatagagccgctcccta
ttggaagcggagtgcagtatgaaagcagagtttcacttggatatttaaatcaatcgttccaaaatgcggttatggagggg
gttctttatggctgcgagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaacttatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7159|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
atgaaaataattaacttaggcattctggctcacgttgacgcaggaaagacaacattaacggagagtttattgtataccag
tggtgcaattgcagaaccagggagcgtagataaaggcacaacaaggacagatacaatgaatttggagcgtcaaaggggaa
tcactatccagacagcagtgacatcttttcagtgggaggatgtaaaagtcaacattatagatacgccaggccatatggat
tttttggcggaagtataccgttctttatccgtattagacggagcagtattattagtttctgcaaaggatggcatacaggc
acagacccgtatactgtttcatgcactacagacaatgaagattccgacaatttttttcatcaataaaattgaccaagagg
ggattgatttgccaatggtatatcaagaaatgaaagcaaagctttcttcggaaattatagtgaagcaaaaggttgggcag
catccccatataaatgtaacggacaatgacgatatggaacagtgggatgcggtaattatgggaaacgatgaactattaga
gaaatatatgtcagggaaaccgtttaaaatgtcagaactggaacaggaagaaaacaggagattccaaaacggaacgttat
ttcccgtttatcacggaagtgctaaaaacaatctggggattcggcagcttatagaagtgattgccagtaagttttattca
tcaacgcctgaaggtcaatctgaactatgcgggcaggtttttaagattgaatattcagagaaaaggcggcgttttgttta
tgtgcgtatatatagcggaacattgcatttgagggatgttattaaaatatctgaaaaagagaaaataaaaatcacagaga
tgtgtgttccgacaaacggtgaattatattcatccgatacagcctgctctggtgatattgtaattttaccaaatgatgtt
ttgcagctaaacagtattttggggaacgaaatgctgttgccgcagagaaaatttattgaaaatcctctccctatgctcca
aacaacgattgcagtaaagaaatctgaacagcgggaaatattgcttggggcacttacagaaatttcagatggcgaccctc
ttttaaaatattatgtggatactacaacgcatgagattatactttcttttttggggaatgtgcagatggaagtcatttgt
gccatccttgaggaaaaatatcatgtggaggcagaaataaaagagcctactgttatatatatggaaagaccgcttagaaa
agcagaatataccatccacatagaagtcccgccaaatcctttctgggcttctgtcgggttgtccatagagccgctcccta
ttggaagcggagtgcagtatgaaagcagagtttcacttggatatttaaatcaatcgttccaaaatgcggttatggagggg
gttctttatggctgcgagcaggggctgtatggatggaaagtgacagactgtaaaatctgttttgaatatggattgtatta
tagtcctgtaagtacccccgcagactttcggctgctttcccctatcgtattggagcaggctttaaaaaaagcagggacag
aactattagagccatatctccactttgaaatttatgcaccgcaggaatatctctcacgggcgtatcatgatgctccaagg
tattgtgcagatattgtaagtactcagataaagaatgacgaggtcattctgaaaggagaaatccctgctagatgtattca
agaatacaggaacgatttaacttatttcacaaatgggcagggagtctgcttgacagagttaaaaggataccagccagcta
ttggtaaatttatttgccaaccccgccgcccgaatagccgtatagataaggttcggcatatgttccacaagttagcttaa

>>MEG_7160|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAAGTATACCGTTCTTTATCCGTATTAGACGGAGCAGTATTATTAGTTTCTGCAAAGGATGGCATACAGGC
ACAGACCCGTATACTGTTTCATGCACTACAGATAATGAAGATTCCGACAATTTTTTTCATCAATAAAATTGACCAAGAGG
GGATTGATTTGCCAATGGTATATCGGGAAATGAAAGCAAAGCTTTCTTCGGAAATTATAGTGAAGCAAAAGGTTGGGCAG
CATCCCCATATAAATGTAACGGACAATGACGATATGGAACAGTGGGATGCGGTAATTATGGGAAACGATGAACTATTAGA
GAAATATATGTCAGGGAAACCGTTTAAAATGTCAGAACTGGAACAGGAAGAAAACAGGAGATTCCAAAACGGAACGTTAT
TTCCCGTTTATCACGGAAGCGCTAAAAACAATCTGGGGACTCGGCAGCTTATAGAAGTAATTGCCAGTAAATTTTATTCA
TCAACGCCTGAAGGTCAATCTGAACTATGCGGGCAGGTTTTTAAGATTGAATATTCAGAGAAAAGGCGGCGTTTTGTTTA
TGTGCGTATATATAGCGGAACATTGCATTTGAGGGATGTTATTAGAATATCTGAAAAAGAGAAAATAAAAATCACAGAGA
TGTATGTTCCGACAAACGGTGAATTATATTCATCCGATACAGCCTGCTCTGGTGATATTGTAATTTTACCAAATGATGTT
TTGCAGCTAAACAGTATTTTGGGGAACGAAATACTGTTGCCGCAGAGAAAATTTATTGAAAATCCTCTCCCTATGATCCA
AACAACGATTGCAGTAAAGAAATCTGAACAGCGGGAAATATTGCTTGGGGCACTTACAGAAATTTCAGATTGCGACCCTC
TTTTAAAATATTATGTGGATACTACAACGCATGAGATTATACTTTCTTTTTTGGGGAATGTGCAGATGGAAGTCATTTGT
GCCATCCTTGAGGAAAAATATCATGTGGAGGCAGAAATAAAAGAGCCTACTGTTATATATATGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTTATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>>MEG_7161|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAGAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACCAGGGAGCGTAGATAAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAAGTATACCGTTCTTTATCCGTATTAGACGGAGCAGTATTATTAGTTTCTGCAAAGGATGGCATACAGGC
ACAGACCCGTATACTGTTTCATGCACTACAGACAATGAAGATTCCGACAATTTTTTTCATCAATAAAATTGACCAAGAGG
GGATTGATTTGCCAATGGTATATCGAGAAATGAAAGCAAAGCTTTCTTCGGAAATTATAGTGAAGCAAAAGGTTGGGCAG
CATCCCCATATAAATGTAACAGACAATGACGATATGGAACAGTGGGATACGGTAATTATGGGAAACGATGAACTATTAGA
GAAATATATGTCAGGGAAACCGTTTAAAATGTCAGAACTGGAACAGGAAGAAAACAGGAGATTCCAAAACGGAACGTTAT
TTCCCGTTTATCACGGAAGCGCTAAAAACAATCTGGGGATTCGGCAGCTTATAGAAGTGATTGCCAGTAAATTTTATTCA
TCAACGCCTGAAGGTCAATCTGAACTATGCGGGCAGGTTTTTAAGATTGAATATTCAGAGAAAAGGCGGCGTTTTGTTTA
TGTGCGTATATATAGCGGAACATTGCATTTGAGGGATGTTATTAGAATATCTGAAAAAGAGAAAATAAAAATCACAGAGA
TGTGTGTTCCGACAAACGGTGAATTATATTCATCCGATACAGCCTGCTCTGGTGATATTGTAATTTTACCAAATGATGTT
TTGCAGCTAAACAGTATTTTGGGGAACGAAATACTGTTGCCGCAGAGAAAATTTATTGAAAATCCTCTCCCTATGCTCCA
AACAACGATTGCAGTAAAGAAATCTGAACAGCGGGAAATATTGCTTGGGGCACTTACAGAAATTTCAGATGGCGACCCTC
TTTTAAAATATTATGTGGATACTACAACGCATGAGATTATACTTTCTTTTTTGGGGAATGTGCAGATGGAAGTCATTTGT
GCCATCCTTGAGGAAAAATATCATGTGGAGGCAGAAATAAAAGAGCCTACTGTTATATATATGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTTATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>>MEG_7162|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAGAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACCAGGGAGCGTAGATAAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAAGTATACCGTTCTTTATCCGTATTAGACGGAGCAGTATTATTAGTTTCTGCAAAGGATGGCATACAGGC
ACAGACCCGTATACTGTTTCATGCACTACAGACAATGAAGATTCCGACAATTTTTTTCATCAATAAAATTGACCAAGAGG
GGATTGATTTGCCAATGGTATATCAAGAAATGAAAGCAAAGCTTTCTTCGGAAATTATAGTGAAGCAAAAGGTTGGGCAG
CATCCCCATATAAATGTAACGGACAATGACGATATGGAACAGTGGGATGCGGTAATTATGGGAAACGATGAACTATTAGA
GAAATATATGTCAGGGAAACCGTTTAAAATGTCAGAACTGGAACAGGAAGAAAACAGGAGATTCCAAAACGGAACGTTAT
TTCCCGTTTATCACGGAAGTGCTAAAAACAATCTGGGGATTCGGCAGCTTATAGAAGTGATTGCCAGTAAGTTTTATTCA
TCAACGCCTGAAGGTCAATCTGAACTATGCGGGCAGGTTTTTAAGATTGAATATTCAGAGAAAAGGCGGCGTTTTGTTTA
TGTGCGTATATATAGCGGAACATTGCATTTGAGGGATGTTATTAAAATATCTGAAAAAGAGAAAATAAAAATCACAGAGA
TGTGTGTTCCGACAAACGGTGAATTATATTCATCCGATACAGCCTGCTCTGGTGATATTGTAATTTTACCAAATGATGTT
TTGCAGCTAAACAGTATTTTGGGGAACGAAATGCTGTTGCCGCAGAGAAAATTTATTGAAAATCCTCTCCCTATGCTCCA
AACAACGATTGCAGTAAAGAAATCTGAACAGCGGGAAATATTGCTTGGGGCACTTACAGAAATTTCAGATGGCGACCCTC
TTTTAAAATATTATGTGGATACTACAACGCATGAGATTATACTTTCTTTTTTGGGGAATGTGCAGATGGAAGTCATTTGT
GCCATCCTTGAGGAAAAATACCATGTGGAGGCAGAAATAAAAGAGCCTACTGTTATATATATGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAACCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCCCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGGTAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCCAGATGTATTCA
AGAATACAGGAACGATTTAACTTATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>>MEG_7163|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCCGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGTGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCCAACCCGGCTCCCTCGTAAAAGGCGGCGTGAGGACCCCCTCCCCATGCTGCG
GACGTCGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGCTGCGAGGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCACCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATCGGACTGTCTGTTACACCACTCCCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCAGGGACGC
AACTGCTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCGGGAATATCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGTCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCAGAGCGTATGCCTTACAGAACTGAAAGGGTATCAGGCCGCTG
TCGGCAAGCCAGTCATCCAGCCCCGCCGTCCAAACAACCGCCTGGACAA

>>MEG_7164|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAAGTATACCGTTCTTTATCCGTATTAGACGGAGCAGTATTATTAGTTTCTGCAAAGGATGGCATACAGGC
ACAGACCCGTATACTGTTTCATGCACTACAGATAATGAAGATTCCGACAATTTTTTTCATCAATAAAATTGACCAAGAGG
GGATTGATTTGCCAATGGTATATCGGGAAATGAAAGCAAAGCTTTCTTCGGAAATTATAGTGAAGCAAAAGGTTGGGCAG
CATCCCCATATAAATGTAACGGACAATGACGATATGGAACAGTGGGATGCGGTAATTATGGGAAACGATGAACTATTAGA
GAAATATATGTCAGGGAAACCGTTTAAAATGTCAGAACTGGAACAGGAAGAAAACAGGAGATTCCAAAACGGAACGTTAT
TTCCCGTTTATCACGGAAGCGCTAAAAACAATCTGGGGATTCGGCAGCTTATAGAAGTAATTGCCAGTAAATTTTATTCA
TCAACGCCTGAAGGTCAATCTGAACTATGCGGGCAGGTTTTTAAGATTGAATATTCAGAGAAAAGGCGGCGTTTTGTTTA
TGTGCGTATATATAGCGGAACATTGCATTTGAGGGATGTTATTAGAATATCTGAAAAAGAGAAAATAAAAATCACAGAGA
TGTGTATTCCGTCAAATGGTGAAATCGTCCCGGCTGACCATGCCTGTCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGATATCCTGGGAAATGAAAAACTCCTGCCTCACAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACCCATGAGATTATGTTATCTTTTTTGGGGAATGTGCAGATGGAAGTCATTTGT
GCCATCCTTGAGGAAAAATATCATGTGGAGGCAGAAATAAAAGAGCCTACTGTTATATATATGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTTGTTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>>MEG_7165|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAAGTATACCGTTCTTTATCCGTATTAGACGGAGCAGTATTATTAGTTTCTGCAAAGGATGGCATACAGGC
ACAGACCCGTATACTGTTTCATGCACTACAGATAATGAAGATTCCGACAATTTTTTTCATCAATAAAATTGACCAAGAGG
GGATTGATTTGCCAATGGTATATCGGGAAATGAAAGCAAAGCTTTCTTCGGAAATTATAGTGAAGCAAAAGGTTGGGCAG
CATCCCCATATAAATGTAACGGACAATGACGATATGGAACAGTGGGATGCGGTAATTATGGGAAACGATGAACTATTAGA
GAAATATATGTCAGGGAAACCGTTTAAAATGTCAGAACTGGAACAGGAAGAAAACAGGAGATTCCAAAACGGAACGTTAT
TTCCCGTTTATCACGGAAGCGCTAAAAACAATCTGGGGATTCGGCAGCTTATAGAAGTAATTGCCAGTAAATTTTATTCA
TCAACGCCTGAAGGTCAATCTGAACTATGCGGGCAGGTTTTTAAGATTGAATATTCAGAGAAAAGGCGGCGTTTTGTTTA
TGTGCGTATATATAGCGGAACATTGCATTTGAGGGATGTTATTAGAATATCTGAAAAAGAGAAAATAAAAATCACAGAGA
TGTGTGTTCCGACAAATGGTGAAATCGTCCCGGCTGACCATGCCTGTCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTGGGAAATGAAAAACTCCTGCCTCACAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTAAAATATTATGTGGATACTACAACGCATGAGATTATACTTTCTTTTTTGGGGAATGTGCAGATGGAAGTCATTTGT
GCCATCCTTGAGGAAAAATATCATGTGGAGGCAGAAATAAAAGAGCCTACTGTTATATATATGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTTATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>>MEG_7166|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAAGTATACCGTTCTTTATCCGTATTAGACGGAGCAGTATTATTAGTTTCTGCAAAGGATGGCATACAGGC
ACAGACCCGTATACTGTTTCATGCACTACAGATAATGAAGATTCCGACAATTTTTTTCATCAATAAAATTGACCAAGAGG
GGATTGATTTGCCAATGGTATATCGGGAAATGAAAGCAAAGCTTTCTTCGGAAATTATAGTGAAGCAAAAGGTTGGGCAG
CATCCCCATATAAATGTAACGGACAATGACGATATGGAACAGTGGGATGCGGTAATTATGGGAAACGATGAACTATTAGA
GAAATATATGTCAGGGAAACCGTTTAAAATGTCAGAACTGGAACAGGAAGAAAACAGGAGATTCCAAAACGGAACGTTAT
TTCCCGTTTATCACGGAAGCGCTAAAAACAATCTGGGGATTCGGCAGCTTATAGAAGTAATTGCCAGTAAATTTTATTCA
TCAACGCCTGAAGGTCAATCTGAACTATGCGGGCAGGTTTTTAAGATTGAATATTCAGAGAAAAGGCGGCGTTTTGTTTA
TGTGCGTATATATAGCGGAACATTGCATTTGAGGGATGTTATTAGAATATCTGAAAAAGAGAAAATAAAGATTACAGAAA
TGTGTATTCCGTCAAATGGTGAAATCGTCCCGGCTGACCATGCCTGTCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTGGGAAATGAAAAACTCCTGCCTCACAAAACATGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACACATGAGATTATGTTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGCTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTTATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>>MEG_7167|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTCGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCACGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGTGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCTTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTAGGAAATGAAAAACTCCTGCCTCATAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACACATGAGATTATGTTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGCTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTAATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>>MEG_7168|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCGAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGCATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCAGGAAAAACTTGCGCGGGAGGAACAGCGGCGGGTTCAAGAAGCCTCCCTGT
TTCCGGTCTATCATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGACTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCACCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGCGGCCAGCGGCGTGTCTA
TCTGCGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGCGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGATCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGCCCCCCTCCCCATGCTGCG
GACGACGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGCTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTCGTTTCC
GCTTTGCTGTCGGAAAAATACAAGATTGAAACAGTGGTAAAGGAACCCACCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCTATCGGACTGTCTGTTACACCACTCCCGC
TTGGCTCCGGCGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCAGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCGGGGACGC
AGCTGCTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGCCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCAGAGCGTATGCCTTACAGAGCTAAAAGGGTATCAGGCCGCTG
TCGGCCAGCCGGTCATCCAGCCCCGCCGTCCAAACAACCGCCTGGACAAGGTGCGCCATATGTTTCAGAAGGTAATGTAA

>>MEG_7169|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGCGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCCAACCCGGCTCCCTCGTAAAAGGTGGCGTGAGGACCCCCTCCCCATGCTGCG
GACGTCGATTGCGCCGAAAACGGCAGCGCAAAGAGCACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGCTGCGAGGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCACCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATCGGACTGTCTGTTACACCACTCCCGC
CTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCAGGGACGC
AACTGCTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCGGGAATATCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGTCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCAGAGCGTATGCCTTACAGAACTGAAAGGGTATCAGGCCGCTG
TCGGCAAGCCAGTCATCCAGCCCCGCCGTCCAAACAACCGCCTGGACAA

>>MEG_7170|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGTGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCCAACCCGGCTCCCTCGTAAAAGGTGGCGTGAGGACCCCCTCCCCATGCTGCG
GACGTCGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGCTGCGAGGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCACCGTCATTTATATAGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATCGGACTGTCTGTTACACCACTCCCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCAGGGACGC
AACTGCTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCGGGAATATCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGTCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCAGAGCGTATGCCTTACAGAACTGAAAGGGTATCAGGCCGCTG
TCGGCAAGCCAGTCATCCAGCCCCGCCGTCCAAACAACCGCCTGGACAA

>>MEG_7171|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTAACCGAAGCATACCGTGCTTTATCTGTCCTTGACGGAGCTGTTTTAGTCATTTCGGCAAAAGACGGCGTACAGGC
ACAGACGCGTATATTATTCCATGCGCTTCAGAAAATGAACATTCCGACAATTATCTTTATAAATAAGATAGACCAAAATG
GAATCGACCTACAGCGTGTTTACCAAAGCATTAAAGACAAACTTACCAGTGATATGATTGTCATGCAGGAGGTTTCCCTG
TCGCCCCAAATATCCATGACCGATATTTCTGATTTGGACAAATGGGATATGATTATTTCCGGAAGCGATGAACTATTAGA
ACGATATGTTGCAGAGGATTCTTTGGATATACAGGAATTACAATATGAAAAGTGCAAAAGAACCAGATGCTGCTCTTTGT
TTCCTGTTTATCATGGGAGTGCAAAAGACAATTTAGGAACAGAAAAACTGATTGAAGCGATTACAGAAACTTTCATTACA
GAAACAGACGATATTCAGTCTGAATTATGTGGATATGTTTTTAAGGTTGAGTATACAGAGCGGAAAAAACGGCTTTCTTA
TTTACGCCTGTATCATGGGACGCTCCATTTACGGGATACCCTGCTGCTGTCAAAAAAGGAAAAAATAAAGATTACAGAAA
TGTGTATTCCGTCAAATGGTGAAATCGTCCCGGCTGACCATGCCTGTCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTGGGAAATGAAAAACTCCTGCCTCACAAAACATGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACACATGAGATTATGTTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGCTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTTATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>>MEG_7172|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGTGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTAGGAAATGAAAAACTCCTGCCTCATAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACACATGAGATTATGTTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGCTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTAATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>>MEG_7173|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGTGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAGCGATGTATTAGGGGACCCAACCCGGCTCCCTCGTAAAAGGTGGCGTGAGGACCCCCTCCCCATGCTGCG
GACGTCGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGAACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGCTGCGAGGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCACCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATCGGACTGTCTGTTACACCACTCCCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCAGGGACGC
AACTGCTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCGGGAATATCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGTCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCAGAGCGTATGCCTTACAGAACTGAAAGGGTATCAGGCCGCTG
TCGGCAAGCCAGTCATCCAGCCCCGCCGTCCAAACAACCGCCTGGACAA

>>MEG_7174|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGG
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGTGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCCGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGTGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGACCCAACCCGGCTCCCTCGTAAAAGGTGGCGTGAGGACCCCCTCCCCATGCTGCG
GACGTCGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGAACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGCTGCGAGGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTTGTTTCC
GCTTTGCTGTCGGAAAAATACAAGCTTGAAACAGTGGTAAAGGAACCCACCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCGCACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCCATCGGACTGTCTGTTACACCACTCCCGC
TTGGCTCCGGTGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCGGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCAGGGACGC
AACTACTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCGGGAATATCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGTCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCCGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCAGAGCGTATGCCTTACAGAACTGAAAGGGTATCAGGCCGCTG
TCGGCAAGCCAGTCATCCAGCCCCGCCGTCCAAACAACCGCCTGGACAA

>>MEG_7175|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCGAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGCATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCAGGAAAAACTTGCGCGGGAGGAACAGCGGCGGGTTCAAGAAGCCTCCCTGT
TTCCGGTCTATCATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGACTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCACCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGCGGCCAGCGGCGTGTCTA
TCTGCGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGCGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGATCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGCCCCCCTCCCCATGCTGCG
GACGACGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGCTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTCGTTTCC
GCTTTGCTGTCGGAAAAATACAAGATTGAAACAGTGGTAAAGGAACCCACCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTTATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCAACAAGTTAGCTTAA

>>MEG_7176|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCCGGCCACATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCGAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGCGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATGCATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCAGGAAAAACTTGCGCGGGAGGAACAGCGGCGGGTTCAAGAAGCCTCCCTGT
TTCCGGTCTATCATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGACTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCACCCTATGCGGCAGCGTTTTCAAGGTTGAGTACACCGATTGCGGCCAGCGGCGTGTCTA
TCTGCGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGCGAAATTGTTATCCTTCCCAGCGACAGC
GTGAGGTTAAACGATGTATTAGGGGATCAAACCCGGCTCCCTCGTAAAAGGTGGCGCGAGGCCCCCCTCCCCATGCTGCG
GACGACGATTGCGCCGAAAACGGCAGCGCAAAGAGAACGGCTGCTGGACGCTCTTACGCAACTTGCGGATACTGACCCGC
TTTTGCGCTGCGAAGTGGATTCCATCACCCATGAGATCATTCTTTCTTTTTTGGGCCGGGTGCAGTTGGAGGTCGTTTCC
GCTTTGCTGTCGGAAAAATACAAGATTGAAACAGTGGTAAAGGAACCCACCGTCATTTATATGGAGCGGCCGCTCAAAGC
AGCCAGCCACACCATCCATATCGAGGTGCCGCCCAACCCGTTTTGGGCATCTATCGGACTGTCTGTTACACCACTCCCGC
TTGGCTCCGGCGTACAATACGAGAGCCGGGTTTCGCTGGGATACTTGAACCAGAGTTTTCAAAACGCTGTCAGGGATGGT
ATCCGTTACGGGCTGGAGCAGGGCTTGTTCGGCTGGAACGTAACGGACTGTAAGATTTGCTTTGAATACGGGCTTTATTA
CAGTCCAGTCAGCACGCCGGCGGACTTCCGCTCATTGGCCCCGATTGTATTGGAACAGGCATTGAAGGAATCGGGGACGC
AGCTGCTGGAACCTTATCTCTCCTTCACCCTCTATGCGCCCCAGGAATACCTTTCCAGGGCTTATCATGATGCACCGAAA
TACTGTGCCACCATCGAAACGGCCCAGGTAAAAAAGGATGAAGTTGTCTTTACTGGCGAGATTCCCGCCCGCTGTATACA
GGCATACCGTACTGATCTGGCCTTTTACACCAACGGGCAGAGCGTATGCCTTACAGAGCTAAAAGGGTATCAGGCCGCTG
TCGGCCAGCCGGTCATCCAGCCCCGCCGTCCAAACAACCGCCTGGACAAGGTGCGCCATATGTTTCAGAAGGTAATGTAA

>>MEG_7177|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETO
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAGAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACCAGGGAGCGTAGATAAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTGGCGGAGGTGTACCGCTCTTTGGCTGTTTTAGATGGGGCCATCTTGGTGATCTCCGCTAAAGATGGCGTGCAGGC
CCAGACCCGTATTCTGTTCCATGCCCTGCGGAAAATGAACATTCCCACCGTTATCTTTATCAACAAGATCGACCAGGCTG
GCGTTGATTTGCAGAGTGTGGTTCAGTCTGTTCGGGATAAGCTCTCCGCCGATATTATCATCAAGCAGACGGTGTCGCTG
TCCCCGGAAATAGTCCTGGAGGAAAATACCGACATAGAAGCATGGGATGCGGTCATCGAAAATAACGATAAATTATTGGA
AAAGTATATCGCAGGAGAACCAATCAGCCGGGAAAAACTTGTGCGGGAGGAACAGCGGCGGGTTCAAGACGCCTCCCTGT
TCCCGGTCTATTATGGCAGCGCCAAAAAGGGCCTTGGCATTCAACCGTTGATGGATGCGGTGACAGGGCTGTTCCAACCG
ATTGGGGAACAGGGGAGCGCCGCCCTATGCGGCAGCGTTTTCAAGGTGGAGTATACAGATTGCGGCCAGCGGCGTGTCTA
TCTACGGCTATACAGCGGAACGCTGCGCCTGCGGGATACGGTGGCCCTGGCCGGGAGAGAAAAGCTGAAAATCACAGAGA
TGCGTATTCCATCCAAAGGGGAAATTGTTCGGACAGACACCGCTTATCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTAGGAAATGAAAAACTCCTGCCTCATAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACACATGAGATTATGTTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGTTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTAATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA