MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TETM

The tetM gene encodes a tetracycline ribosomal protection protein.

References

  • http://aac.asm.org/content/47/12/3675

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>>MEG_7103|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcataattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtccgtctgaactttgcggaaatgttttcaaaattgaatatacaaaaaaaagacaacgtcttgcata
tatacgcctttatagtggagtactacatttacgagattcggttagagtatcagaaaaagaaaaaataaaagttacagaaa
tgtatacttcaataaatggtgaattatgtaagattgatagagcttattctggagaaattgttattttgcaaaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtctatctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcgaatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcgatgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtaggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7104|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcataattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtccgtctgaactttgcggaaatgttttcaaaattgaatatacaaaaaaaagacaacgtcttgcata
tatacgcctttatagtggagtactacatttacgagattcggttagagtatcagaaaaagaaaaaataaaagttacagaaa
tgtatacttcaataaatggtgaattatgtaagattgatagagcttattctggagaaattgttattttgcaaaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggaaggg
atacgctatggttgcgaacaaggattatatggttggaatgtgacggattgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7105|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcataattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtccgtctgaactttgcggaaatgttttcaaaattgaatatacaaaaaaaagacaacgtcttgcata
tatacgcctttatagtggagtactacatttacgagattcggttagagtatcagaaaaagaaaaaataaaagttacagaaa
tgtatacttcaataaatggtgaattatgtaagattgatagagcttattctggagaaattgttattttgcaaaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgcggccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggaaggg
atacgctatggttgcgaacaaggattatatggttggaatgtgacggattgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7106|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatgtgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttctctgt
tccctctttatcatggaagtgcaaaaagtaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagatccggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacgactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctgcgatattatgtggattctgcgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctgctgcaagaaaagtatcatgtggagatagaaataaaagagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagttccaccgaatcctttctgggcttccattggtctatctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7107|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattgtttcatgcacttaggaaaataggtattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgcggaaattgtaatcaaacagaaggtagaactg
catcctaatatgcgtgtaatgaactttaccgaatctgaacaatgggatatggtaatagaaggaaatgattaccttttgga
gaaatatacgtctgggaaattattggaagcattagaactcgaacaagaggaaagcataagatttcataattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcacaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacgactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctgcgatattatgtggattctgcgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctgctgcaagaaaagtatcatgtggagatagaaataaaagagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagttccaccgaatcctttctgggcttccattggtctatctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7108|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaatctaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagatttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatgtgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttctctgt
tccctctttatcatggaagtgcaaaaagtaatatagggattgataaccttatagaagttattactaataaattttattca
tcaacacatcgaggtccgtctgaactttgcggaaatgttttcaaaattgaatatacaaaaaaaagacaacgtcttgcata
tatacgcctttatagtggagtactacatttacgagattcggttagagtatcagaaaaagaaaaaataaaagttacagaaa
tgtatacttcaataaatggtgaattatgtaagattgatagagcttattctggagaaattgttattttgcaaaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggaaggg
atacgctatggttgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataatataacttag

>>MEG_7109|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcgggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatacgtctgggaaattattggaagcattagaactcgaacaagaggaaagcataagatttcataattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgaatatacaaaaaaaagacaacgtcttgcata
tatacgcctttatagtggagtactacatttacgagattcggttagagtatcagaaaaagaaaaaataaaagttacagaaa
tgtatacttcaataaatggtgaattatgtaagattgatagagcttattctggagaaattgttattttgcaaaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7110|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcgggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcataattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaatgttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcagaaagggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacgactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctgcgatattatgtggattctgcgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctgctgcaagaaaagtatcatgtggagatagaaataaaagagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagttccaccgaatcctttctgggcttccattggtctatctgtagcacagcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7111|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcgggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacagaggtacaacgaaaacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattgtttcatgcacttaggaaaataggtattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcaaaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7112|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcgggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacagaggtacaacgaaaacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacggcgataacctcttttcagtggaaaaatactaagataaacatcatagacacgccaggacatatggat
tttttagcagaagtatatcgttcattatcagtattagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattgtttcatgcacttaggaaaataggtattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgcggaaattgtaatcaaacagaaggtagaactg
catcctaatatgcgtgtaatgaactttaccgaatctgaacaatgggatatggtaatagaaggaaatgattaccttttgga
gaaatatacgtctgggaaattattggaagcattagaactcgaacaagaggaaagcataagatttcataattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacgactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctgcgatattatgtggattctgcgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctgctgcaagaaaagtatcatgtggagatagaaataaaagagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagttccaccgaatcctttctgggcttccattggtctatctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7113|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcgggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacagaggtacaacgaaaacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacggcgataacctcttttcagtggaaaaatactaagataaacatcatagacacgccaggacatatggat
tttttagcagaagtatatcgttcattatcagtattagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattgtttcatgcacttaggaaaataggtattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgcggaaattgtaatcaaacagaaggtagaactg
catcctaatatgcgtgtaatgaactttaccgaatctgaacaatgggatatggtaatagaaggaaatgattaccttttgga
gaaatatacgtctgggaaattattggaagcattagaactcgaacaagaggaaagcataagatttcataattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacggctgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctgcgatattatgtggattctgcgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctgctgcaagaaaagtatcatgtggagatagaaataaaagagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagttccaccgaatcctttctgggcttccattggtctatctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaacttcctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7114|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatataggtgttttagctcatgttgacgcaggaaaaactactttgacagaaagcttactatatactag
tggagcgattgcggagtcaggaagcgtggatacaggcacaacaagaacggatactacatttttagaacgtcagcgaggaa
ttacaattcagacagcagtaacctcttttcagtggaaagatattaaggtaaatatcatagatactccaggacatatggat
tttttagcagaagtatatcgctcgttatcagttttagatggggcaatcctactaatttctgcgagagatggagtacaagc
acaaactcggatattatttcatgcactaaataaaatgggtattcccacaatcttttttatcaataagattgaccaaaatg
ggattgatttatcaacggtttatcaagatattaaagagaaactttctatggaaattataatcaaacagaaagtagagctg
caccctaatatgtgtgtgatgagctgtacggaacctgagcaatgggatgtggtaatagaaggaaatgattatcttttgga
gaaatatacacttgggaaatcattggagatattagaactcgaacaagaggaaatcagaagatttcagaattgctccttgt
accctgtttatcatggaagcgcaaaaagcaacatagggattgagcagcttatagaagtgataacgaataaattttattca
tcaacatacagaaagaagtctgaactttgcggaaatgtcttcaaaattgaatattcggaagaaagacaacgtcttgcata
tgtacgcctttatggcggaatcctgcatttgcgggattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaattgataaggcttattccggggaaattgttattttgcaaaatgagttt
ttgaagctaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatccgctccctctgctgca
aacaactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctacaatattatgtggattctacgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctattgcaagaaaagtatcatgtggaggtaaaaataaaaaagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagtgccaccgaatcccttctgggcttccattggtctttctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggaaggg
atacgatatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagttttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcaccacaagaatatctttcacgagcatataacgatgctcctaaa
tattgtgcgaacatcgtagacactcaactgaaaaataatgaggtcattcttagtggagaaattcctgctcggtgtattca
agaatatcgtaatgatttaactttctttacaaatggacgtagcgtttgtttaacagagttaaaagggtactatgttacta
ctggtgaatctgtttgtcagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7115|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggaattttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttctctgt
tccctctttatcatggaagtgcaaaaagtaatatagggattgataaccttatagaagttattactaataaattttattca
tcaacacatcgaggtccgtctgaactttgcggaaatgttttcaaaattgaatatacaaaaaaaagacaacgtcttgcata
tatacgcctttatagtggagtactacatttacgagattcggttagagtatcagaaaaagaaaaaataaaagttacagaaa
tgtatacttcaataaatggtgaattatgtaagattgatagagcttattctggagaaattgttattttgcaaaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggaaggg
atacgctatggttgcgaacaaggattatatggttggaatgtgacggattgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7116|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggaattttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttctctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaagattgatagagcttattctggagaaattgttattttgcaaaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggaaggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7117|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgacgcaggaaaaactactttgacagaaagcttactatatactag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactccaacaagaggaaagcataagatttcataattgttccctgt
tccctgtttattacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtccgtctgaactttgcggaaatgttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacgactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctgcgatattatgtggattctgcgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctgctgcaagaaaagtatcatgtggagatagaaataaaagagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagttccaccgaatcctttctgggcttccattggtctatctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7118|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacagataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctatggaaattataatcaaacagaaagtagagctg
caccctaatatgtgtgtgatgagctgtacggaacctgagcaatgggatgtggtaatagaaggaaatgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattagaactcgaacaagaggaaatcagaagatttcagaattgctccttgt
accctgtttatcatggaagcgcaaaaagcaacatagggattgagcagcttatagaagtgataacgaataaattttattca
tcaacatacagaaagaagtctgaactttgcggaaatgtcttcaaaattgaatattcggaagaaagacaacgtcttgcata
tgtacgcctttatggcggaatcctgcatttgcgggattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaattgataaggcttattccggggaaattgttattttgcaaaatgagttt
ttgaagctaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatccgctccctctgctgca
aacaactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctacaatattatgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggaaggg
atacgctatggttgcgaacaaggattatatggttggaatgtgacggattgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7119|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctatggaaattataatcaaacagaaagtagagctg
caccctaatatgtgtgtgatgagctgtacggaacctgagcaatgggatgtggtaatagaaggaaatgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattagaactcgaacaagaggaaatcagaagatttcagaattgctccttgt
accctgtttatcatggaagcgcaaaaagcaacatagggattgagcagcttatagaagtgataacgaataaattttattca
tcaacatacagaaagaagtctgaactttgcggaaatgtcttcaaaattgaatattcggaagaaagacaacgtcttgcata
tgtacgcctttatggcggaatcctgcatttgcgggattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaattgataaggcttattccggggaaattgttattttgcaaaatgagttt
ttgaagctaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatccgctccctctgctgca
aacaactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctacaatattatgtggattctacgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctattgcaagaaaagtatcatgtggaggtaaaaataaaaaagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagtgccaccgaatcccttctgggcttccattggtctttctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggaaggg
atacgatatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagttttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcaccacaagaatatctttcacgagcatataacgatgctcccaaa
tattgtgcaaatatcgtaaatactcaactgaaaaataatgaggtcattcttagtggagaaattcctgctcggtgtattca
agaatatcgtaatgatttaactttctttacaaatggacgtagcgtttgtttaacagagttaaaagggtactatgttacta
ctggtgaatctgtttgtcagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7120|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctatggaaattataatcaaacagaaagtagagctg
caccctaatatgtgtgtgatgagctgtacggaacttgagcaatgggatgtggtaatagaaggaaatgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattagaactcgaacaagaggaaatcagaagatttcagaattgctccttgt
accctgtttatcatggaagcgcaaaaagcaacatagggattgagcagcttatagaagtgataacgaataaattttattca
tcaacatacagaaagaagtctgaactttgcggaaatgtcttcaaaattgaatattcggaagaaagacaacgtcttgcata
tgtacgcctttatggcggaatcctgcatttgcgggattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaattgataaggcttattccggggaaattgttattttgcaaaatgagttt
ttgaagctaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatccgctccctctgctgca
aacaactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctacaatattatgtggattctacgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctattgcaagaaaagtatcatgtggaggtaaaaataaaaaagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagtgccaccgaatcccttctgggcttccattggtctttctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggaaggg
atacgatatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagttttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcaccacaagaatatctttcacgagcatataacgatgctcctaaa
tattgtgcgaacatcgtagacactcaactgaaaaataatgaggtcattcttagtggagaaattcctgctcggtgtattca
agaatatcgtaatgatttaactttctttacaaatggacgtagcgtttgtttaacagagttaaaagggtactatgttacta
ctggtgaatctgtttgtcagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7121|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgacgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcataattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtccgtctgaactttgcggaaatgttttcaaaattgaatatacaaaaaaaagacaacgtcttgcata
tatacgcctttatagtggagtactacatttacgagattcggttagagtatcagaaaaagaaaaaataaaagttacagaaa
tgtatacttcaataaatggtgaattatgtaagattgatagagcttattctggagaaattgttattttgcaaaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggaaggg
atacgctatggttgcgaacaaggattatatggttggaatgtgacggattgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7122|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
catcctaatatgcgtgtaatgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaatcagaagatttcagaattgctccttgt
accctgtttatcatggaagcgcaaaaagcaacatagggattgagcagcttatagaagtgattacgaataaattttattca
tcaacatacagaaagaagtctgaactttgcggaattgtcttcaaaattgaatattcggaagaaagacaacgtcttgcata
tgtacgcctttatggcggaatcctgcatttgcgggattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaattgataaggcttattccggggaaattgttattttgcaaaatgagttt
ttgaagctaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatccgctccctctgctgca
aacaactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctacaatattatgtggattctacgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctattgcaagaaaagtatcatgtggaggtaaaaataaaaaagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagtgccaccgaatcccttctgggcttccattggtctttctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggaaggg
atacgatatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagttttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcaccacaagaatatctttcacgagcatataacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggagaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7123|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
catcctaatatgcgtgtaatgaactttaccgaatctgaacaatgggatatggtaatagaaggaaatgattaccttttgga
gaaatatacgtctgggaaattattggaagcattagaactcgaacaagaggaaagcataagatttcataattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacgactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctgcgatattatgtggattctgcgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgcccaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggaaggg
atacgctatggttgcgaacaaggattatatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7124|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgctccttgt
accctgtttatcatggaagcgcaaaaagcaacatagggattgagcagcttatagaagtgataacgaataaattttattca
tcaacatacagaaagaagtctgaactttgcggaaatgtcttcaaaattgaatattcggaagaaagacaacgtcttgcata
tgtacgcctttatggcggaatcctgcatttgcgggattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaattgataaggcttattccggggaaattgttattttgcaaaatgagttt
ttgaagctaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatccgctccctctgctgca
aacaactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggaaggg
atacgctatggttgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7125|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgcctttatagtggcgtactgcatttgcgagatccggttagaatatcggaaaaggaaaaaataaaagttacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattctggagaaattgttattttgcaaaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtctatctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7126|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttctctgt
tccctctttatcatggaagtgcaaaaagtaatatagggattgataaccttatagaagttattactaataaattttattca
tcaacacatcgaggtccgtctgaactttgcggaaatgttttcaaaattgaatatacaaaaaaaagacaacgtcttgcata
tatacgcctttatagtggagtactacatttacgagattcggttagagtatcagaaaaagaaaaaataaaagttacagaaa
tgtatacttcaataaatggtgaattatgtaagattgatagagcttattctggagaaattgttattttgcaaaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggaaggg
atacgctatggttgcgaacaaggattatatggttggaatgtgacggattgtaaaatctgttttaagtacggtttatacta
tagccctgttagtactccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7127|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttctctgt
tccctctttatcatggaagtgcaaaaagtaatatagggattgataaccttatagaagttattactaataaattttattca
tcaacacatcgaggtccgtctgaactttgcggaaatgttttcaaaattgaatatacaaaaaaaagacaacgtcttgcata
tatacgcctttatagtggagtactacatttacgagattcggttagagtatcagaaaaggaaaaaataaaagttacagaaa
tgtatacttcaataaatggtgaattatgtaagattgatagagcttattctggagaaattgttattttgcataatgagttt
ttgaagttaaatagtgttcgtggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaaataacagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtctatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaattcctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7128|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttctctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaaactattgccacagagaaaaaagattgaaaatccgcaccctctactaca
aacaactgttgaaccgagtaaacctgaacagagagaaatgttacttgatgcacttttagaaatctccgacagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccgt
tgggaagtggaatgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggaaggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcagatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7129|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttctctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacgactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctgcgatattatgtggattctgcgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctgctgcaagaaaagtatcatgtggagatagaaataaaagagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagttccaccgaatcctttctgggcttccattggtctatctgtagcacagcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7130|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcaggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatgtgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttctctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaagggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacgactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctgcgatattatgtggattctgcgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gctctgctgcaagaaaagtatcatgtggagatagaaataaaagagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagttccaccgaatcctttctgggcttccattggtctatctgtagcacagcttccat
tagggagcggagtgcagtatgagagctcggtttctcttggatacttaaatcaatcatttcaaaatgcagttatggagggg
atacgctatggttgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagcacgatatatgttcaataaaataacttag

>>MEG_7131|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcgggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaatgttttcaaaattgaatatacaaaaaaaagacaacgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacgactgttgaaccgagcaaacctcaacaaagggaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccat
tagggagcggagtgcagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattcaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7132|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcgggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacaaaggtacaacgaggacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacaggaataacctcttttcagtgggaaaatacgaaggtgaacatcatagacacgccaggacatatggat
ttcttagcagaagtatatcgttcattatcagttttagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattatttcatgcacttaggaaaatggggattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgccgaaattgtaatcaaacagaaggtagaactg
tatcctaatatgtgtgtgacgaactttaccgaatctgaacaatgggatacggtaatagagggaaacgatgaccttttaga
gaaatatatgtccggtaaatcattagaagcattggaactcgaacaagaggaaagcataagatttcagaattgttccctgt
tccctgtttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaatgttttcaaaattgaatatacaaaaaaaagacaacgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacgactgttgaaccgagcaaacctcaacaaagggaaatgttgcttgatgcccttttggaaatctcagatagtgatccgc
ttctacgatattacgtggattctacgacacatgaaattatactttctttcttagggaaagtacaaatggaagtgattagt
gcactgttgcaagaaaagtatcatgtggagatagaactaaaagagcctacagtcatttatatggagagaccgttaaaaaa
tgcagaatataccattcacatcgaagtgccgccaaatcctttctgggcttccattggtttatctgtatcaccgcttccat
tagggagcggagtgcagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7133|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
atgaaaattattaatattggagttttagctcatgttgatgcgggaaaaactaccttaacagaaagcttattatataacag
tggagcgattacagaattaggaagcgtggacagaggtacaacgaaaacggataatacgcttttagaacgtcagagaggaa
ttacaattcagacggcgataacctcttttcagtggaaaaatactaagataaacatcatagacacgccaggacatatggat
tttttagcagaagtatatcgttcattatcagtattagatggggcaattctactgatttctgcaaaagatggcgtacaagc
acaaactcgtatattgtttcatgcacttaggaaaataggtattcccacaatcttttttatcaataagattgaccaaaatg
gaattgatttatcaacggtttatcaggatattaaagagaaactttctgcggaaattgtaatcaaacagaaggtagaactg
catcctaatatgcgtgagatgaactttaccgaatctgaacaatgggatatggtaatagaaggaaatgattaccttttgga
gaaatatacgtctgggaaattattggaagcattagaactcgaacaagaggaaagcataagatttcataattgttccctgt
tccctctttatcacggaagtgcaaaaaacaatatagggattgataaccttatagaagtgattacgaataaattttattca
tcaacacatcgaggtcagtctgaactttgcggaaaagttttcaaaattgagtattcggaaaaaagacagcgtcttgcata
tatacgtctttatagtggcgtactgcatttgcgagattcggttagaatatcggaaaaggaaaaaataaaaattacagaaa
tgtatacttcaataaatggtgaattatgtaaaatcgataaggcttattccggggaaattgttattttgcagaatgagttt
ttgaagttaaatagtgttcttggagatacaaagctattgccacagagagagagaattgaaaatcccctccctctgctgca
aacgactgttgaaccgagcaaacctcaacaaagggaaatgttacttgatgcacttttagaaatctccgacagtgacccgc
ttctgcgatattatgtggattctgcgacacatgaaatcatactttctttcttagggaaagtacaaatggaagtgacttgt
gcactgctgcaagaaaagtatcatgtggagatagaaataaaagagcctacagtcatttatatggaaagaccgttaaaaaa
agcagagtataccattcacatcgaagttccaccgaatcctttctgggcttccattggtctatctgtagcaccgcttccat
tagggagcggagtacagtatgagagctcggtttctcttggatacttaaatcaatcgtttcaaaatgcagttatggagggg
atacgctatggctgtgaacaaggattgtatggttggaatgtgacggactgtaaaatctgttttaagtatggcttatacta
tagccctgttagtaccccagcagattttcggatgcttgctcctattgtattggaacaagtcttaaaaaaagctggaacag
aattgttagagccatatcttagttttaaaatttatgcgccacaggaatatctttcacgagcatacaacgatgctcctaaa
tattgtgcgaacatcgtagacactcaattgaaaaataatgaggtcattcttagtggagaaatccctgctcggtgtattca
agaatatcgtagtgatttaactttctttacaaatggacgtagtgtttgtttaacagagttaaaagggtaccatgttacta
ccggtgaacctgtttgccagccccgtcgtccaaatagtcggatagataaagtacgatatatgttcaataaaataacttag

>>MEG_7134|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTGTTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAATGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCATAATTGTTCCCTGT
TCCCTGTTTATCACGGAAGTGCAAAAAACAATATAGGGATTGATAACCTTATAGAAGTGATTACGAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAAGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAGAATTGAAAATCCGCATCCTCTACTACA
AATAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGCGAACAAGGATTATATGGTTGGAATGTGACGGAATGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>>MEG_7135|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGTTCTCTGT
TCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTTATTACTAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGTCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATCGATAAGGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAGAATTGAAAATCCGCACCCTCTACTACA
AACAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGCGAACAAGGATTATATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>>MEG_7136|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATTTCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGTTCTCTGT
TCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTTATTACTAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAAGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAAGATTGAAAATCCGCACCCTCTACTACA
AACAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGCGAACAAGGATTATATGGTTGGAATGTGACGGATTGTAAAATCTGTTTTAAGTACGGTTTATACTA
TAGCCCTGTTAGTACTCCAGCAGATTTTCGGATGCTTACTCCTATTGTACTGGAGCAAGCCTTTAGAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAGTTTATGCACCACAGGAATATCTTTCACGGGCATATAACGATGCTCCCAAA
TATTGTGCAAATATCGTAAATACTCAACTGAAAAATAATGAGGTCATTATTATTGGAGAAATTCCTGCTCGATGTATTCA
AGATTATCGCAATGATTTAACTTTTTTTACAAATGGGCTTAGTGTTTGTTTAGCAGAGCTAAAAGGATATCAGGTTACCA
CTGGCGAACCTGTTTGCCAGACCCGTCGTCTAAATAGTCGGATAGATAAAGTAAGATATATGTTCAATAAAATAACTTAG

>>MEG_7137|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGTTCTCTGT
TCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTGATTACGAATAAATTTTATTCA
TCAACACATCGAGGTCAGTCTGAACTTTGCGGAAAAGTTTTCAAAATTGAGTATTCGGAAAAAAGACAGCGTCTTGCATA
TATACGTCTTTATAGTGGCGTACTGCATTTGCGAGATTCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATCGATAAGGCTTATTCCGGGGAAATTGTTATTTTGCAGAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAGCTATTGCCACAGAGAGAGAGAATTGAAAATCCCCTCCCTCTGCTGCA
AACGACTGTTGAACCGAGCAAACCTCAACAAAGGGAAATGTTACTTGATGCACTTTTAGAAATCTCCGACAGTGACCCGC
TTCTGCGATATTATGTGGATTCTGCGACACATGAAATCATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGACTTGT
GCTCTGCTGCAAGAAAAGTATCATGTGGAGATAGAAATAAAAGAGCCTACAGTCATTTATATGGAAAGACCGTTAAAAAA
AGCAGAGTATACCATTCACATCGAAGTTCCACCGAATCCTTTCTGGGCTTCCATTGGTCTATCTGTAGCACAGCTTCCAT
TAGGGAGCGGAGTACAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCGTTTCAAAATGCAGTTATGGAGGGG
ATACGCTATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>>MEG_7138|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATAGGTGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGCTCCTTGT
ACCCTGTTTATCATGGAAGCGCAAAAAGCAACATAGGGATTGAGCAGCTTATAGAAGTGATAACGAATAAATTTTATTCA
TCAACATACAGAAAGAAGTCTGAACTTTGCGGAAATGTCTTCAAAATTGAATATTCGGAAGAAAGACAACGTCTTGCATA
TGTACGCCTTTATGGCGGAATCCTGCATTTGCGGGATTCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATTGATAAGGCTTATTCCGGGGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGCTAAATAGTGTTCTTGGAGATACAAAGCTATTGCCACAGAGAGAGAGAATTGAAAATCCGCTCCCTCTGCTGCA
AACAACTGTTGAACCGAGCAAACCTCAACAAAGGGAAATGTTACTTGATGCACTTTTAGAAATCTCCGACAGTGACCCGC
TTCTACAATATTATGTGGATTCTACGACACATGAAATCATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGACTTGT
GCTCTATTGCAAGAAAAGTATCATGTGGAGGTAAAAATAAAAAAGCCTACAGTCATTTATATGGAAAGACCGTTAAAAAA
AGCAGAGTATACCATTCACATCGAAGTGCCACCGAATCCCTTCTGGGCTTCCATTGGTCTTTCTGTAGCACCGCTTCCAT
TAGGGAGCGGAGTACAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCGTTTCAAAATGCAGTTATGGAAGGG
ATACGATATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTTTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCACCACAAGAATATCTTTCACGAGCATATAACGATGCTCCCAAA
TATTGTGCAAATATCGTAAATACTCAACTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATTCCTGCTCGGTGTATTCA
AGAATATCGTAATGATTTAACTTTCTTTACAAATGGACGTAGCGTTTGTTTAACAGAGTTAAAAGGGTACTATGTTACTA
CTGGTGAATCTGTTTGTCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>>MEG_7139|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCGGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAGAGGTACAACGAAAACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACGGCGATAACCTCTTTTCAGTGGAAAAATACTAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTTTTAGCAGAAGTATATCGTTCATTATCAGTATTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTGTTTCATGCACTTAGGAAAATAGGTATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCGGAAATTGTAATCAAACAGAAGGTAGAACTG
CATCCTAATATGCGTGTAATGAACTTTACCGAATCTGAACAATGGGATATGGTAATAGAAGGAAATGATTACCTTTTGGA
GAAATATACGTCTGGGAAATTATTGGAAGCATTAGAACTCGAACAAGAGGAAAGCATAAGATTTCATAATTGTTCCCTGT
TCCCTGTTTATCACGGAAGTGCAAAAAACAATATAGGGATTGATAACCTTATAGAAGTGATTACGAATAAATTTTATTCA
TCAACACATCGAGGTCAGTCTGAACTTTGCGGAAAAGTTTTCAAAATTGAGTATTCGGAAAAAAGACAGCGTCTTGCATA
TATACGTCTTTATAGTGGCGTACTGCATTTGCGAGATCCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATCGATAAGGCTTATTCCGGGGAAATTGTTATTTTGCAGAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAGCTATTGCCACAGAGAGAGAGAATTGAAAATCCCCTCCCTCTGCTGCA
AACGACTGTTGAACCGAGCAAACCTCAACAAAGGGAAATGTTACTTGATGCACTTTTAGAAATCTCCGACAGTGACCCGC
TTCTGCGATATTATGTGGATTCTGCGACACATGAAATCATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGACTTGT
GCTCTGCTGCAAGAAAAGTATCATGTGGAGATAGAAATAAAAGAGCCTACAGTCATTTATATGGAAAGACCGTTAAAAAA
AGCAGAGTATACCATTCACATCGAAGTTCCACCGAATCCTTTCTGGGCTTCCATTGGTCTATCTGTAGCACCGCTTCCAT
TAGGGAGCGGAGTACAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCGTTTCAAAATGCAGTTATGGAGGGG
ATACGCTATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>>MEG_7140|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCATAATTGTTCCCTGT
TCCCTGTTTATCACGGAAGTGCAAAAAACAATATAGGGATTGATAACCTTATAGAAGTGATTACGAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAAGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAAGATTGAAAATCCGCACCCTCTACTACG
AACAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGCGAACAAGGATTATATGGTTGGAATGTGACGGATTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATACGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>>MEG_7141|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATGTGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGTTCTCTGT
TCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTTATTACTAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAGGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAAGATTGAAAATCCGCACCCTCTACTACA
AACAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAAATAACAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTCTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>>MEG_7142|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATGTGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGTTCTCTGT
TCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTTATTACTAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAAGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAAGATTGAAAATCCGCACCCTCTACTACA
AACAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>>MEG_7143|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCGGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCATAATTGTTCCCTGT
TCCCTGTTTATCACGGAAGTGCAAAAAACAATATAGGGATTGATAACCTTATAGAAGTGATTACGAATAAATTTTATTCA
TCAACACATCGAGGTCAGTCTGAACTTTGCGGAAAAGTTTTCAAAATTGAGTATTCGGAAAAAAGACAGCGTCTTGCATA
TATACGTCTTTATAGTGGCGTACTGCATTTGCGAGATTCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATCGATAAGGCTTATTCCGGGGAAATTGTTATTTTGCAGAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAGCTATTGCCACAGAGAGAGAGAATTGAAAATCCCCTCCCTCTGCTGCA
AACGACTGTTGAACCGAGCAAACCTCAACAAAGGGAAATGTTACTTGATGCACTTTTAGAAATCTCCGACAGTGACCCGC
TTCTGCGATATTATGTGGATTCTGCGACACATGAAATCATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGACTTGT
GCTCTGCTGCAAGAAAAGTATCATGTGGAGATAGAAATAAAAGAGCCTACAGTCATTTATATGGAAAGACCGTTAAAAAA
AGCAGAGTATACCATTCACATCGAAGTTCCACCGAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACACCGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>>MEG_7144|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGCTCCTTGT
ACCCTGTTTATCATGGAAGCGCAAAAAGCAACATAGGGATTGAGCAGCTTATAGAAGTGATAACGAATAAATTTTATTCA
TCAACATACAGAAAGAAGTCTGAACTTTGCGGAAATGTCTTCAAAATTGAATATTCGGAAGAAAGACAACGTCTTGCATA
TGTACGCCTTTATGGCGGAATCCTGCATTTGCGGGATTCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATTGATAAGGCTTATTCCGGGGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGCTAAATAGTGTTCTTGGAGATACAAAGCTATTGCCACAGAGAGAGAGAATTGAAAATCCGCTCCCTCTGCTGCA
AACAACTGTTGAACCGAGCAAACCTCAACAAAGGGAAATGTTACTTGATGCACTTTTAGAAATCTCCGACAGTGACCCGC
TTCTACAATATTATGTGGATTCTACGACACATGAAATCATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGACTTGT
GCTCTATTGCAAGAAAAGTATCATGTGGAGGTAAAAATAAAAAAGCCTACAGTCATTTATATGGAAAGACCGTTAAAAAA
AGCAGAGTATACCATTCACATCGAAGTGCCACCGAATCCCTTCTGGGCTTCCATTGGTCTTTCTGTAGCACCGCTTCCAT
TAGGGAGCGGAGTACAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCGTTTCAAAATGCAGTTATGGAAGGG
ATACGATATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTTTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCACCACAAGAATATCTTTCACGAGCATATAACGATGCTCCCAAA
TATTGTGCAAATATCGTAAATACTCAACTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATTCCTGCTCGGTGTATTCA
AGAATATCGTAATGATTTAACTTTCTTTACAAATGGACGTAGCGTTTGTTTAACAGAGTTAAAAGGGTACTATGTTACTA
CTGGTGAATCTGTTTGTCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>>MEG_7145|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
CTAAGTTATTTTATTGAACATATATCGTACTTTATCTATCCGACTATTTGGACGACGGGGCTGGCAAACAGGTTCACCGG
TAGTAACATGGTACCCTTTTAACTCTGTTAAACAAACACTACGTCCATTTGTAAAGAAAGTTAAATCACTACGATATTCT
TGAATACACCGAGCAGGGATTTCTCCACTAAGAATGACCTCATTATTTTTCAATTGAGTGTCTACGATGTTCGCACAATA
TTTAGGAGCATCGTTGTATGCTCGTGAAAGATATTCCTGTGGCGCATAAATTTTAAAACTAAGATATGGCTCTAACAATT
CTGTTCCAGCTTTTTTTAAGACTTGTTCCAATACAATAGGAGCAAGCATCCGAAAATCTGCTGGGGTACTAACAGGGCTA
TAGTATAAGCCATACTTAAAACAGATTTTACAGTCCGTCACATTCCAACCATACAATCCTTGTTCACAGCCATAGCGTAT
CCCCTCCATAACTGCATTTTGAAACGATTGATTTAAGTATCCAAGAGAAACCGAGCTCTCATACTGCATTCCACTTCCCA
ACGGAAGCGGTGATACAGATAAACCAATGGAAGCCCAGAAAGGATTTGGCGGCACTTCGATGTGAATGGTATATTCTGCA
TTTTTTAACGGTCTCTCCATATAAATGACTGTAGGCTCTTTTAGTTCTATCTCCACATGATACTTTTCTTGCAACAGTGC
ACTAATCACTTCCATTTGTACTTTCCCTAAGAAAGAAAGTATAATTTCATGTGTCGTAGAATCCACGTAATATCGTAGAA
GCGGATCACTATCTGAGATTTCCAAAAGGGCATCAAGCAACATTTCTCTCTGTTCAGGTTTACTCGGTTCAACAGTTGTT
TGTAGTAGAGGGTGCGGATTTTCAATCTTTTTTCTCTGTGGCAATAGTTTTGTATCTCCAAGAACACTATTTAACTTCAA
AAACTCATTTTGCAAAATAACAATTTCTCCAGAATAAGCTCTATCAATCTTACATAATTCACCATTTATTGAAGTATACA
TTTCTGTAACTTTTATTTTTTCTTTTTCTGATACTCTAACCGAATCTCGTAAATGTAGTACTCCACTATAAAGGCGTATA
TATGCAAGACGTTGTCTTTTTTTTGTATATTCAATTTTGAAAACATTTCCGCAAAGTTCAGACGGACCTCGATGTGTTGA
TGAATAAAATTTATTAGTAATAACTTCTATAAGGTTATCAATCCCTATATTACTTTTTGCACTTCCATGATAAAGAGGGA
ACAGAGAACAATTCTGAAATCTTATGCTTTCCTCTTGTTCGAGTTCCAATGCTTCTAATGATTTACCGGACATATATTTC
TCTAAAAGGTCATCGTTTCCCTCTATTACCGTATCCCATTGTTCAGATTCGGTAAAGTTCGTCACACACATATTAGGATA
CAGTTCTACCTTCTGTTTGATTACAATTTCGGCAGAAAGTTTCTCTTTAATATCCTGATAAACCGTTGATAAATCAATTC
CATTTTGGTCAATCTTATTGATAAAAAAGATTGTGGGAATCCCCATTTTCCTAAGTGCATGAAATAATATACGAGTTTGT
GCTTGTACGCCATCTTTTGCAGAAATCAGTAGAATTGCCCCATCTAAAACTGATAATGAACGATATACTTCTGCTAAGAA
ATCCATATGTCCTGGCGTGTCTATGATGTTCACCTTCGTATTTTCCCACTGAAAAGAGGTTATTCCTGTCTGAATTGTAA
TTCCTCTCTGACGTTCTAAAAGCGTATTATCCGTCCTCGTTGTACCTTTGTCCACGCTTCCTAATTCTGTAATCGCTCCA
CTGTTATATAATAAGCTTTCTGTTAAGGTAGTTTTTCCTGCATCAACATGAGCTAAAACTCCAATATTAATAATTTTCAT

>>MEG_7146|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
CTAAGTTATTTTATTGAACATATATCTTACTTTATCTATCCGACTATTTAGACGACGGGTCTGGCAAACAGGTTCGCCAG
TGGTAACCTGATATCCTTTTAGCTCTGCTAAACAAACACTAAGCCCATTTGTAAAAAAAGTTAAATCATTGCGATAATCT
TGAATACATCGAGCAGGAATTTCTCCAATAATAATGACCTCATTATTTTTCAGTTGAGTATTTACGATATTTGCACAATA
TTTGGGAGCATCGTTATATGCCCGTGAAAGATATTCCTGTGGTGCATAAACTTTAAAACTAAGATATGGCTCTAACAATT
CTGTTCCAGCTTTTCTAAAGGCTTGCTCCAGTACAATAGGAGTAAGCATCCGAAAATCTGCTGGAGTACTAACAGGGCTA
TAGTATAAACCGTACTTAAAACAGATTTTACAATCCGTCACATTCCAACCATATAATCCTTGTTCGCAACCATAGCGTAT
CCCTTCCATAACTGCATTTTGAAATGATTGATTTAAGTATCCAAGAGAAACCGAGCTCTCATACTGCATTCCACTTCCCA
ACGGAAGCGGTGATACAGATAAACCAATGGAAGCCCAGAAAGGATTTGGCGGCACTTCGATGTGAATGGTATATTCTGCA
TTTTTTAACGGTCTCTCCATATAAATGACTGTAGGCTCTTTTAGTTCTATCTCCACATGATACTTTTCTTGCAACAGTGC
ACTAATCACTTCCATTTGTACTTTCCCTAAGAAAGAAAGTATAATTTCATGTGTCGTAGAATCCACGTAATATCGTAGAA
GCGGATCACTATCTGAGATTTCCAAAAGGGCATCAAGCAACATTTCTCTCTGTTCAGGTTTACTCGGTTCAACAGTTGTT
TGTAGTAGAGGGTGCGGATTTTCAATCTTTTTTCTCTGTGGCAATAGTTTTGTATCTCCAAGAACACTATTTAACTTCAA
AAACTCATTTTGCAAAATAACAATTTCTCCAGAATAAGCTCTATCAATCTTACATAATTCACCATTTATTGAAGTATACA
TTTCTGTAACTTTTATTTTTTCTTTTTCTGATACTCTAACCGAATCTCGTAAATGTAGTACTCCACTATAAAGGCGTATA
TATGCAAGACGTTGTCTTTTTTTTGTATATTCAATTTTGAAAACATTTCCGCAAAGTTCAGACGGACCTCGATGTGTTGA
TGAATAAAATTTATTAGTAATAACTTCTATAAGGTTATCAATCCCTATATTACTTTTTGCACTTCCATGATAAAGAGGGA
ACAGAGAACAATTCTGAAATCTTATGCTTTCCTCTTGTTCGAGTTCCAATGCTTCTAATGATTTACCGGACATATATTTC
TCTAAAAGGTCATCGTTTCCCTCTATTACCGTATCCCATTGTTCAGATTCGGTAAAGTTCGTCACACACATATTAGGATA
CAGTTCTACCTTCTGTTTGATTACAATTTCGGCAGAAAGTTTCTCTTTAATATCCTGATAAACCGTTGATAAATCAATTC
CATTTTGGTCAATCTTATTGATAAAAAAGATTGTGGGAATCCCCATTTTCCTAAGTGCATGAAATAATATACGAGTTTGT
GCTTGTACGCCATCTTTTGCAGAAATCAGTAGAATTGCCCCATCTAAAACTGATAATGAACGATATACTTCTGCTAAGAA
ATCCATATGTCCTGGCGTGTCTATGATGTTCACCTTCGTATTTTCCCACTGAAAAGAGGTTATTCCTGTCTGAATTGTAA
TTCCTCTCTGACGTTCTAAAAGCGTATTATCCGTCCTCGTTGTACCTTTGTCCACGCTTCCTAATTCTGTAATCGCTCCA
CTGTTATATAATAAGCTTTCTGTTAAGGTAGTTTTTCCTGCATCAACATGAGCTAAAACTCCAATATTAATAATTTTCAT

>>MEG_7147|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGGAGGAAATAAAATTGAAAATTATTAATATCGGTATCTTAGCACATGTTGATGCAGGAAAAACTACTTTGACAGAAAG
CTTACTATACAGTAGCGGAGCAATTAAAGAGTTAGGAAGTGTAGATAGCGGTACAACGAAAACGGATACTATGTTTTTGG
AACGCCAGAGAGGTATTACTATTCAGACCGCAATAACATCTTTTCAACGGGAAAATGTTAAAGTAAATATTGTAGATACT
CCTGGACACATGGATTTTTTGGCAGATGTATACCGTTCATTATCTGTTTTGGATGGAGCTATTTTGCTAATCTCTGCAAA
AGATGGAGTACAGTCACAAACTCGTATACTATTCCATGCACTTAGAAAGATGAACATACCTATAATATTTTTTATTAACA
AAATTGATCAAAATGGAATAAATTTGCCAGATGTTTATCAAGATATTAAGGACAAACTTTCTGACGACATCATAATTAAG
CAGACTGTGAATCTAAATTTGAAACCTTATGTAATAGATTATACTGAACCAGAACAATGGGAGACAGTAATTGTGGGAAA
TGATTATTTATTAGAAAAATATACCATTGGGAAAACATTGAATATTGCAGAACTTGAAAAGGAGGAAAACGAAAGAATTC
AAAGTTGCTCCTTATATCCTGTTTATCACGGAAGTGCAAAGAATAATATTGGAATTAAACAACTTATAGAGGTAATTACT
AGCAAATTATTTTCACCCACACAACTCAATTCAGATAAACTTTGTGGAAATGTTTTTAAAGTAGAATATTCAGATGATGG
TCAACGGCTTGTCTATGTACGTCTTTATAGTGGAACGCTACATTTGCGAGACTCAGTCAATATATCAGAAAAGGAAAAAA
TAAAAGTTACAGAAATGTATACTTCAATAAATGGAGAATTACGCCAGATAGATAAGGCAGAGCCTGGTGAGATTATTATT
TTAAAAAATGAGCTTTTAAAACTAAATAACGTACTTGGAGATAAAAAAAGATTACCACATAGAGAAATTCTTGAGAATCC
TCTTCCTATGTTACAAACAACAATTGAACCATGTAAATCAGTACAAAGAGAAAAGTTACTAGATGCACTTTTTGAAATAT
CCGATAGTGATCCCCTTCTACAATATTATGTAGATACAGTAACTCACGAAATTGTGCTATCTTTTTTAGGTGAGGTCCAA
ATGGAGGTAACTTGTACTCTGATTCAAGAAAAATATCATATTGAGATAGAAACAAGAAAACCAACTGTCATTTATATGGA
AAGACCATTAAAAAAATCTGAATTTACCATTGATATCGAAGTACCTCCAAATCCTTTCTGGGCTTCTATTGGTTTATCTG
TAACACCACTTCCTTTGGGTAGTGGCATTCAGTATGAGAGCCTGGTTTCTCTAGGTTATTTAAATCAATCATTTCAAAAT
GCAGTTATGGAAGGTATACGCTATGGGTGTGAACAAGGATTGTACGGTTGGAAATTAACAGACTGTAAGATCTGTTTTAA
GTATGGTCTATATTACAGCCCTGTCAGTACGCCAGCAGATTTCCGAATGCTTGCGCCTATTGTACTAGAGCAGGCTTTTA
GAAAGAGTGGTACAGAGTTATTAGAGCCATATCTTAGCTTCGAAATTTATGTACCACAAGAATATCTTTCGAGAGCATAT
AATGATGCTTCCAAATATTGTGCAAATATTTTAAATACTAAGTTAAAAGGTAACGAGGTCATTCTCATTGGTGAAATCCC
TGCTCGGTGTATTCAAGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAG
GGTACCATGTTACTACCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTC
AATAAAATAACTTAG

>>MEG_7148|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGGAGGAAATAAAATTGAAAATTATTAATATCGGTATCTTAGCACATGTTGATGCAGGAAAAACTACTTTGACAGAAAG
CTTACTATACAGTAGCGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAG
AACGTCAGAGAGGAATTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACG
CCAGGACATATGGATTTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAA
AGATGGCGTACAAGCACAAACTCGTATATTGTTTCATGCACTTAGGAAAATAGGTATTCCCACAATCTTTTTTATCAATA
AGATTGACCAAAATGGAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCGGAAATTGTAATCAAA
CAGAAGGTAGAACTGTATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAA
CGATGACCTTTTAGAGAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTC
AGAATTGTTCTCTGTTCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTTATTACT
AATAAATTTTATTCATCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAG
ACAACGTCTTGCATATATACGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAAGAAAAAA
TAAAAGTTACAGAAATGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATT
TTGCAAAATGAGTTTTTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAAGATTGAAAATCC
GCACCCTCTACTACAAACAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCT
CAGATAGTGATCCGCTTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAA
ATGGAAGTGATTAGTGCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTTATATGGA
GAGACCGTTAAAAAATGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTG
TATCACCGCTTCCGTTGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAAT
GCAGTTATGGAAGGGATACGCTATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAA
GTATGGCTTATACTATAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAA
AAAAAGCTGGAACAGAATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATAC
AACGATGCTCCTAAATATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCC
TGATCGGTGTATTCAAGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAG
GGTACCATGTTACTACCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTC
AATAAAATAACTTAG