MEGAResFrom MEG, the Microbial Ecology Group

TETM

The tetM gene encodes a tetracycline ribosomal protection protein.

References

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>Tet|tetM_4_X75073|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCATAATTGTTCCCTGT
TCCCTGTTTATCACGGAAGTGCAAAAAACAATATAGGGATTGATAACCTTATAGAAGTGATTACGAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAAGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAAGATTGAAAATCCGCACCCTCTACTACG
AACAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGCGAACAAGGATTATATGGTTGGAATGTGACGGATTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATACGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>Tet|AM180355.1|gene636|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATAGGTGTTTTAGCTCATGTTGACGCAGGAAAAACTACTTTGACAGAAAGCTTACTATATACTAG
TGGAGCGATTGCGGAGTCAGGAAGCGTGGATACAGGCACAACAAGAACGGATACTACATTTTTAGAACGTCAGCGAGGAA
TTACAATTCAGACAGCAGTAACCTCTTTTCAGTGGAAAGATATTAAGGTAAATATCATAGATACTCCAGGACATATGGAT
TTTTTAGCAGAAGTATATCGCTCGTTATCAGTTTTAGATGGGGCAATCCTACTAATTTCTGCGAGAGATGGAGTACAAGC
ACAAACTCGGATATTATTTCATGCACTAAATAAAATGGGTATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GGATTGATTTATCAACGGTTTATCAAGATATTAAAGAGAAACTTTCTATGGAAATTATAATCAAACAGAAAGTAGAGCTG
CACCCTAATATGTGTGTGATGAGCTGTACGGAACCTGAGCAATGGGATGTGGTAATAGAAGGAAATGATTATCTTTTGGA
GAAATATACACTTGGGAAATCATTGGAGATATTAGAACTCGAACAAGAGGAAATCAGAAGATTTCAGAATTGCTCCTTGT
ACCCTGTTTATCATGGAAGCGCAAAAAGCAACATAGGGATTGAGCAGCTTATAGAAGTGATAACGAATAAATTTTATTCA
TCAACATACAGAAAGAAGTCTGAACTTTGCGGAAATGTCTTCAAAATTGAATATTCGGAAGAAAGACAACGTCTTGCATA
TGTACGCCTTTATGGCGGAATCCTGCATTTGCGGGATTCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATTGATAAGGCTTATTCCGGGGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGCTAAATAGTGTTCTTGGAGATACAAAGCTATTGCCACAGAGAGAGAGAATTGAAAATCCGCTCCCTCTGCTGCA
AACAACTGTTGAACCGAGCAAACCTCAACAAAGGGAAATGTTACTTGATGCACTTTTAGAAATCTCCGACAGTGACCCGC
TTCTACAATATTATGTGGATTCTACGACACATGAAATCATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGACTTGT
GCTCTATTGCAAGAAAAGTATCATGTGGAGGTAAAAATAAAAAAGCCTACAGTCATTTATATGGAAAGACCGTTAAAAAA
AGCAGAGTATACCATTCACATCGAAGTGCCACCGAATCCCTTCTGGGCTTCCATTGGTCTTTCTGTAGCACCGCTTCCAT
TAGGGAGCGGAGTACAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCGTTTCAAAATGCAGTTATGGAAGGG
ATACGATATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTTTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCACCACAAGAATATCTTTCACGAGCATATAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAACTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATTCCTGCTCGGTGTATTCA
AGAATATCGTAATGATTTAACTTTCTTTACAAATGGACGTAGCGTTTGTTTAACAGAGTTAAAAGGGTACTATGTTACTA
CTGGTGAATCTGTTTGTCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>Tet|tetM_9_X56353|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATGTGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGTTCTCTGT
TCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTTATTACTAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAGGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAAGATTGAAAATCCGCACCCTCTACTACA
AACAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAAATAACAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTCTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>Tet|tetM_12_FR671418|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGTTCTCTGT
TCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTGATTACGAATAAATTTTATTCA
TCAACACATCGAGGTCAGTCTGAACTTTGCGGAAAAGTTTTCAAAATTGAGTATTCGGAAAAAAGACAGCGTCTTGCATA
TATACGTCTTTATAGTGGCGTACTGCATTTGCGAGATTCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATCGATAAGGCTTATTCCGGGGAAATTGTTATTTTGCAGAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAGCTATTGCCACAGAGAGAGAGAATTGAAAATCCCCTCCCTCTGCTGCA
AACGACTGTTGAACCGAGCAAACCTCAACAAAGGGAAATGTTACTTGATGCACTTTTAGAAATCTCCGACAGTGACCCGC
TTCTGCGATATTATGTGGATTCTGCGACACATGAAATCATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGACTTGT
GCTCTGCTGCAAGAAAAGTATCATGTGGAGATAGAAATAAAAGAGCCTACAGTCATTTATATGGAAAGACCGTTAAAAAA
AGCAGAGTATACCATTCACATCGAAGTTCCACCGAATCCTTTCTGGGCTTCCATTGGTCTATCTGTAGCACAGCTTCCAT
TAGGGAGCGGAGTACAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCGTTTCAAAATGCAGTTATGGAGGGG
ATACGCTATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>Tet|tetM_10_EU182585|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGCTCCTTGT
ACCCTGTTTATCATGGAAGCGCAAAAAGCAACATAGGGATTGAGCAGCTTATAGAAGTGATAACGAATAAATTTTATTCA
TCAACATACAGAAAGAAGTCTGAACTTTGCGGAAATGTCTTCAAAATTGAATATTCGGAAGAAAGACAACGTCTTGCATA
TGTACGCCTTTATGGCGGAATCCTGCATTTGCGGGATTCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATTGATAAGGCTTATTCCGGGGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGCTAAATAGTGTTCTTGGAGATACAAAGCTATTGCCACAGAGAGAGAGAATTGAAAATCCGCTCCCTCTGCTGCA
AACAACTGTTGAACCGAGCAAACCTCAACAAAGGGAAATGTTACTTGATGCACTTTTAGAAATCTCCGACAGTGACCCGC
TTCTACAATATTATGTGGATTCTACGACACATGAAATCATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGACTTGT
GCTCTATTGCAAGAAAAGTATCATGTGGAGGTAAAAATAAAAAAGCCTACAGTCATTTATATGGAAAGACCGTTAAAAAA
AGCAGAGTATACCATTCACATCGAAGTGCCACCGAATCCCTTCTGGGCTTCCATTGGTCTTTCTGTAGCACCGCTTCCAT
TAGGGAGCGGAGTACAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCGTTTCAAAATGCAGTTATGGAAGGG
ATACGATATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTTTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCACCACAAGAATATCTTTCACGAGCATATAACGATGCTCCCAAA
TATTGTGCAAATATCGTAAATACTCAACTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATTCCTGCTCGGTGTATTCA
AGAATATCGTAATGATTTAACTTTCTTTACAAATGGACGTAGCGTTTGTTTAACAGAGTTAAAAGGGTACTATGTTACTA
CTGGTGAATCTGTTTGTCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>Tet|TetM|U08812|1981-3900|1920|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTGTTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAATGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCATAATTGTTCCCTGT
TCCCTGTTTATCACGGAAGTGCAAAAAACAATATAGGGATTGATAACCTTATAGAAGTGATTACGAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAAGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAGAATTGAAAATCCGCATCCTCTACTACA
AATAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGCGAACAAGGATTATATGGTTGGAATGTGACGGAATGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>Tet|tetM_7_FN433596|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
CTAAGTTATTTTATTGAACATATATCTTACTTTATCTATCCGACTATTTAGACGACGGGTCTGGCAAACAGGTTCGCCAG
TGGTAACCTGATATCCTTTTAGCTCTGCTAAACAAACACTAAGCCCATTTGTAAAAAAAGTTAAATCATTGCGATAATCT
TGAATACATCGAGCAGGAATTTCTCCAATAATAATGACCTCATTATTTTTCAGTTGAGTATTTACGATATTTGCACAATA
TTTGGGAGCATCGTTATATGCCCGTGAAAGATATTCCTGTGGTGCATAAACTTTAAAACTAAGATATGGCTCTAACAATT
CTGTTCCAGCTTTTCTAAAGGCTTGCTCCAGTACAATAGGAGTAAGCATCCGAAAATCTGCTGGAGTACTAACAGGGCTA
TAGTATAAACCGTACTTAAAACAGATTTTACAATCCGTCACATTCCAACCATATAATCCTTGTTCGCAACCATAGCGTAT
CCCTTCCATAACTGCATTTTGAAATGATTGATTTAAGTATCCAAGAGAAACCGAGCTCTCATACTGCATTCCACTTCCCA
ACGGAAGCGGTGATACAGATAAACCAATGGAAGCCCAGAAAGGATTTGGCGGCACTTCGATGTGAATGGTATATTCTGCA
TTTTTTAACGGTCTCTCCATATAAATGACTGTAGGCTCTTTTAGTTCTATCTCCACATGATACTTTTCTTGCAACAGTGC
ACTAATCACTTCCATTTGTACTTTCCCTAAGAAAGAAAGTATAATTTCATGTGTCGTAGAATCCACGTAATATCGTAGAA
GCGGATCACTATCTGAGATTTCCAAAAGGGCATCAAGCAACATTTCTCTCTGTTCAGGTTTACTCGGTTCAACAGTTGTT
TGTAGTAGAGGGTGCGGATTTTCAATCTTTTTTCTCTGTGGCAATAGTTTTGTATCTCCAAGAACACTATTTAACTTCAA
AAACTCATTTTGCAAAATAACAATTTCTCCAGAATAAGCTCTATCAATCTTACATAATTCACCATTTATTGAAGTATACA
TTTCTGTAACTTTTATTTTTTCTTTTTCTGATACTCTAACCGAATCTCGTAAATGTAGTACTCCACTATAAAGGCGTATA
TATGCAAGACGTTGTCTTTTTTTTGTATATTCAATTTTGAAAACATTTCCGCAAAGTTCAGACGGACCTCGATGTGTTGA
TGAATAAAATTTATTAGTAATAACTTCTATAAGGTTATCAATCCCTATATTACTTTTTGCACTTCCATGATAAAGAGGGA
ACAGAGAACAATTCTGAAATCTTATGCTTTCCTCTTGTTCGAGTTCCAATGCTTCTAATGATTTACCGGACATATATTTC
TCTAAAAGGTCATCGTTTCCCTCTATTACCGTATCCCATTGTTCAGATTCGGTAAAGTTCGTCACACACATATTAGGATA
CAGTTCTACCTTCTGTTTGATTACAATTTCGGCAGAAAGTTTCTCTTTAATATCCTGATAAACCGTTGATAAATCAATTC
CATTTTGGTCAATCTTATTGATAAAAAAGATTGTGGGAATCCCCATTTTCCTAAGTGCATGAAATAATATACGAGTTTGT
GCTTGTACGCCATCTTTTGCAGAAATCAGTAGAATTGCCCCATCTAAAACTGATAATGAACGATATACTTCTGCTAAGAA
ATCCATATGTCCTGGCGTGTCTATGATGTTCACCTTCGTATTTTCCCACTGAAAAGAGGTTATTCCTGTCTGAATTGTAA
TTCCTCTCTGACGTTCTAAAAGCGTATTATCCGTCCTCGTTGTACCTTTGTCCACGCTTCCTAATTCTGTAATCGCTCCA
CTGTTATATAATAAGCTTTCTGTTAAGGTAGTTTTTCCTGCATCAACATGAGCTAAAACTCCAATATTAATAATTTTCAT

>Tet|tetM_13_AM990992|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
CTAAGTTATTTTATTGAACATATATCGTACTTTATCTATCCGACTATTTGGACGACGGGGCTGGCAAACAGGTTCACCGG
TAGTAACATGGTACCCTTTTAACTCTGTTAAACAAACACTACGTCCATTTGTAAAGAAAGTTAAATCACTACGATATTCT
TGAATACACCGAGCAGGGATTTCTCCACTAAGAATGACCTCATTATTTTTCAATTGAGTGTCTACGATGTTCGCACAATA
TTTAGGAGCATCGTTGTATGCTCGTGAAAGATATTCCTGTGGCGCATAAATTTTAAAACTAAGATATGGCTCTAACAATT
CTGTTCCAGCTTTTTTTAAGACTTGTTCCAATACAATAGGAGCAAGCATCCGAAAATCTGCTGGGGTACTAACAGGGCTA
TAGTATAAGCCATACTTAAAACAGATTTTACAGTCCGTCACATTCCAACCATACAATCCTTGTTCACAGCCATAGCGTAT
CCCCTCCATAACTGCATTTTGAAACGATTGATTTAAGTATCCAAGAGAAACCGAGCTCTCATACTGCATTCCACTTCCCA
ACGGAAGCGGTGATACAGATAAACCAATGGAAGCCCAGAAAGGATTTGGCGGCACTTCGATGTGAATGGTATATTCTGCA
TTTTTTAACGGTCTCTCCATATAAATGACTGTAGGCTCTTTTAGTTCTATCTCCACATGATACTTTTCTTGCAACAGTGC
ACTAATCACTTCCATTTGTACTTTCCCTAAGAAAGAAAGTATAATTTCATGTGTCGTAGAATCCACGTAATATCGTAGAA
GCGGATCACTATCTGAGATTTCCAAAAGGGCATCAAGCAACATTTCTCTCTGTTCAGGTTTACTCGGTTCAACAGTTGTT
TGTAGTAGAGGGTGCGGATTTTCAATCTTTTTTCTCTGTGGCAATAGTTTTGTATCTCCAAGAACACTATTTAACTTCAA
AAACTCATTTTGCAAAATAACAATTTCTCCAGAATAAGCTCTATCAATCTTACATAATTCACCATTTATTGAAGTATACA
TTTCTGTAACTTTTATTTTTTCTTTTTCTGATACTCTAACCGAATCTCGTAAATGTAGTACTCCACTATAAAGGCGTATA
TATGCAAGACGTTGTCTTTTTTTTGTATATTCAATTTTGAAAACATTTCCGCAAAGTTCAGACGGACCTCGATGTGTTGA
TGAATAAAATTTATTAGTAATAACTTCTATAAGGTTATCAATCCCTATATTACTTTTTGCACTTCCATGATAAAGAGGGA
ACAGAGAACAATTCTGAAATCTTATGCTTTCCTCTTGTTCGAGTTCCAATGCTTCTAATGATTTACCGGACATATATTTC
TCTAAAAGGTCATCGTTTCCCTCTATTACCGTATCCCATTGTTCAGATTCGGTAAAGTTCGTCACACACATATTAGGATA
CAGTTCTACCTTCTGTTTGATTACAATTTCGGCAGAAAGTTTCTCTTTAATATCCTGATAAACCGTTGATAAATCAATTC
CATTTTGGTCAATCTTATTGATAAAAAAGATTGTGGGAATCCCCATTTTCCTAAGTGCATGAAATAATATACGAGTTTGT
GCTTGTACGCCATCTTTTGCAGAAATCAGTAGAATTGCCCCATCTAAAACTGATAATGAACGATATACTTCTGCTAAGAA
ATCCATATGTCCTGGCGTGTCTATGATGTTCACCTTCGTATTTTCCCACTGAAAAGAGGTTATTCCTGTCTGAATTGTAA
TTCCTCTCTGACGTTCTAAAAGCGTATTATCCGTCCTCGTTGTACCTTTGTCCACGCTTCCTAATTCTGTAATCGCTCCA
CTGTTATATAATAAGCTTTCTGTTAAGGTAGTTTTTCCTGCATCAACATGAGCTAAAACTCCAATATTAATAATTTTCAT

>Tet|tetM_11_JN846696|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATAGGTGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGCTCCTTGT
ACCCTGTTTATCATGGAAGCGCAAAAAGCAACATAGGGATTGAGCAGCTTATAGAAGTGATAACGAATAAATTTTATTCA
TCAACATACAGAAAGAAGTCTGAACTTTGCGGAAATGTCTTCAAAATTGAATATTCGGAAGAAAGACAACGTCTTGCATA
TGTACGCCTTTATGGCGGAATCCTGCATTTGCGGGATTCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATTGATAAGGCTTATTCCGGGGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGCTAAATAGTGTTCTTGGAGATACAAAGCTATTGCCACAGAGAGAGAGAATTGAAAATCCGCTCCCTCTGCTGCA
AACAACTGTTGAACCGAGCAAACCTCAACAAAGGGAAATGTTACTTGATGCACTTTTAGAAATCTCCGACAGTGACCCGC
TTCTACAATATTATGTGGATTCTACGACACATGAAATCATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGACTTGT
GCTCTATTGCAAGAAAAGTATCATGTGGAGGTAAAAATAAAAAAGCCTACAGTCATTTATATGGAAAGACCGTTAAAAAA
AGCAGAGTATACCATTCACATCGAAGTGCCACCGAATCCCTTCTGGGCTTCCATTGGTCTTTCTGTAGCACCGCTTCCAT
TAGGGAGCGGAGTACAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCGTTTCAAAATGCAGTTATGGAAGGG
ATACGATATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTTTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCACCACAAGAATATCTTTCACGAGCATATAACGATGCTCCCAAA
TATTGTGCAAATATCGTAAATACTCAACTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATTCCTGCTCGGTGTATTCA
AGAATATCGTAATGATTTAACTTTCTTTACAAATGGACGTAGCGTTTGTTTAACAGAGTTAAAAGGGTACTATGTTACTA
CTGGTGAATCTGTTTGTCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>Tet|tetM_2_X90939|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCGGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCATAATTGTTCCCTGT
TCCCTGTTTATCACGGAAGTGCAAAAAACAATATAGGGATTGATAACCTTATAGAAGTGATTACGAATAAATTTTATTCA
TCAACACATCGAGGTCAGTCTGAACTTTGCGGAAAAGTTTTCAAAATTGAGTATTCGGAAAAAAGACAGCGTCTTGCATA
TATACGTCTTTATAGTGGCGTACTGCATTTGCGAGATTCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATCGATAAGGCTTATTCCGGGGAAATTGTTATTTTGCAGAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAGCTATTGCCACAGAGAGAGAGAATTGAAAATCCCCTCCCTCTGCTGCA
AACGACTGTTGAACCGAGCAAACCTCAACAAAGGGAAATGTTACTTGATGCACTTTTAGAAATCTCCGACAGTGACCCGC
TTCTGCGATATTATGTGGATTCTGCGACACATGAAATCATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGACTTGT
GCTCTGCTGCAAGAAAAGTATCATGTGGAGATAGAAATAAAAGAGCCTACAGTCATTTATATGGAAAGACCGTTAAAAAA
AGCAGAGTATACCATTCACATCGAAGTTCCACCGAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACACCGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>Tet|tetM_5_U58985|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGTTCTCTGT
TCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTTATTACTAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGTCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATCGATAAGGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAGAATTGAAAATCCGCACCCTCTACTACA
AACAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGCGAACAAGGATTATATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>Tet|tetM_6_M21136|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATTTCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATATGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGTTCTCTGT
TCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTTATTACTAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAAGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAAGATTGAAAATCCGCACCCTCTACTACA
AACAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGCGAACAAGGATTATATGGTTGGAATGTGACGGATTGTAAAATCTGTTTTAAGTACGGTTTATACTA
TAGCCCTGTTAGTACTCCAGCAGATTTTCGGATGCTTACTCCTATTGTACTGGAGCAAGCCTTTAGAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAGTTTATGCACCACAGGAATATCTTTCACGGGCATATAACGATGCTCCCAAA
TATTGTGCAAATATCGTAAATACTCAACTGAAAAATAATGAGGTCATTATTATTGGAGAAATTCCTGCTCGATGTATTCA
AGATTATCGCAATGATTTAACTTTTTTTACAAATGGGCTTAGTGTTTGTTTAGCAGAGCTAAAAGGATATCAGGTTACCA
CTGGCGAACCTGTTTGCCAGACCCGTCGTCTAAATAGTCGGATAGATAAAGTAAGATATATGTTCAATAAAATAACTTAG

>Tet|tetM_8_X04388|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCGGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAGAGGTACAACGAAAACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACGGCGATAACCTCTTTTCAGTGGAAAAATACTAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTTTTAGCAGAAGTATATCGTTCATTATCAGTATTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTGTTTCATGCACTTAGGAAAATAGGTATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCGGAAATTGTAATCAAACAGAAGGTAGAACTG
CATCCTAATATGCGTGTAATGAACTTTACCGAATCTGAACAATGGGATATGGTAATAGAAGGAAATGATTACCTTTTGGA
GAAATATACGTCTGGGAAATTATTGGAAGCATTAGAACTCGAACAAGAGGAAAGCATAAGATTTCATAATTGTTCCCTGT
TCCCTGTTTATCACGGAAGTGCAAAAAACAATATAGGGATTGATAACCTTATAGAAGTGATTACGAATAAATTTTATTCA
TCAACACATCGAGGTCAGTCTGAACTTTGCGGAAAAGTTTTCAAAATTGAGTATTCGGAAAAAAGACAGCGTCTTGCATA
TATACGTCTTTATAGTGGCGTACTGCATTTGCGAGATCCGGTTAGAATATCGGAAAAGGAAAAAATAAAAATTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAAATCGATAAGGCTTATTCCGGGGAAATTGTTATTTTGCAGAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAGCTATTGCCACAGAGAGAGAGAATTGAAAATCCCCTCCCTCTGCTGCA
AACGACTGTTGAACCGAGCAAACCTCAACAAAGGGAAATGTTACTTGATGCACTTTTAGAAATCTCCGACAGTGACCCGC
TTCTGCGATATTATGTGGATTCTGCGACACATGAAATCATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGACTTGT
GCTCTGCTGCAAGAAAAGTATCATGTGGAGATAGAAATAAAAGAGCCTACAGTCATTTATATGGAAAGACCGTTAAAAAA
AGCAGAGTATACCATTCACATCGAAGTTCCACCGAATCCTTTCTGGGCTTCCATTGGTCTATCTGTAGCACCGCTTCCAT
TAGGGAGCGGAGTACAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCGTTTCAAAATGCAGTTATGGAGGGG
ATACGCTATGGCTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG

>Tet|tetM_1_X92947|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TETM
ATGAAAATTATTAATATTGGAGTTTTAGCTCATGTTGATGCAGGAAAAACTACCTTAACAGAAAGCTTATTATATAACAG
TGGAGCGATTACAGAATTAGGAAGCGTGGACAAAGGTACAACGAGGACGGATAATACGCTTTTAGAACGTCAGAGAGGAA
TTACAATTCAGACAGGAATAACCTCTTTTCAGTGGGAAAATACGAAGGTGAACATCATAGACACGCCAGGACATATGGAT
TTCTTAGCAGAAGTATATCGTTCATTATCAGTTTTAGATGGGGCAATTCTACTGATTTCTGCAAAAGATGGCGTACAAGC
ACAAACTCGTATATTATTTCATGCACTTAGGAAAATGGGGATTCCCACAATCTTTTTTATCAATAAGATTGACCAAAATG
GAATTGATTTATCAACGGTTTATCAGGATATTAAAGAGAAACTTTCTGCCGAAATTGTAATCAAACAGAAGGTAGAACTG
TATCCTAATGTGTGTGTGACGAACTTTACCGAATCTGAACAATGGGATACGGTAATAGAGGGAAACGATGACCTTTTAGA
GAAATATATGTCCGGTAAATCATTAGAAGCATTGGAACTCGAACAAGAGGAAAGCATAAGATTTCAGAATTGTTCTCTGT
TCCCTCTTTATCATGGAAGTGCAAAAAGTAATATAGGGATTGATAACCTTATAGAAGTTATTACTAATAAATTTTATTCA
TCAACACATCGAGGTCCGTCTGAACTTTGCGGAAATGTTTTCAAAATTGAATATACAAAAAAAAGACAACGTCTTGCATA
TATACGCCTTTATAGTGGAGTACTACATTTACGAGATTCGGTTAGAGTATCAGAAAAAGAAAAAATAAAAGTTACAGAAA
TGTATACTTCAATAAATGGTGAATTATGTAAGATTGATAGAGCTTATTCTGGAGAAATTGTTATTTTGCAAAATGAGTTT
TTGAAGTTAAATAGTGTTCTTGGAGATACAAAACTATTGCCACAGAGAAAAAAGATTGAAAATCCGCACCCTCTACTACA
AACAACTGTTGAACCGAGTAAACCTGAACAGAGAGAAATGTTGCTTGATGCCCTTTTGGAAATCTCAGATAGTGATCCGC
TTCTACGATATTACGTGGATTCTACGACACATGAAATTATACTTTCTTTCTTAGGGAAAGTACAAATGGAAGTGATTAGT
GCACTGTTGCAAGAAAAGTATCATGTGGAGATAGAACTAAAAGAGCCTACAGTCATTTATATGGAGAGACCGTTAAAAAA
TGCAGAATATACCATTCACATCGAAGTGCCGCCAAATCCTTTCTGGGCTTCCATTGGTTTATCTGTATCACCGCTTCCGT
TGGGAAGTGGAATGCAGTATGAGAGCTCGGTTTCTCTTGGATACTTAAATCAATCATTTCAAAATGCAGTTATGGAAGGG
ATACGCTATGGTTGTGAACAAGGATTGTATGGTTGGAATGTGACGGACTGTAAAATCTGTTTTAAGTATGGCTTATACTA
TAGCCCTGTTAGTACCCCAGCAGATTTTCGGATGCTTGCTCCTATTGTATTGGAACAAGTCTTAAAAAAAGCTGGAACAG
AATTGTTAGAGCCATATCTTAGTTTTAAAATTTATGCGCCACAGGAATATCTTTCACGAGCATACAACGATGCTCCTAAA
TATTGTGCGAACATCGTAGACACTCAATTGAAAAATAATGAGGTCATTCTTAGTGGAGAAATCCCTGCTCGGTGTATTCA
AGAATATCGTAGTGATTTAACTTTCTTTACAAATGGACGTAGTGTTTGTTTAACAGAGTTAAAAGGGTACCATGTTACTA
CCGGTGAACCTGTTTGCCAGCCCCGTCGTCCAAATAGTCGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAG