MEGAResFrom MEG, the Microbial Ecology Group

TET44

The tet44 gene encodes a tetracycline ribosomal protection protein.

References

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>Tet|tet44_1_NZ_ABDU01000081|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET44
TTAATTTTCTTTTTTATTAAACATATGGCGTACTTTATCTATTCGATTATTTGGTCTGCGTGATTGAATAACTGGTTCAC
AAGTAGCAATTTGATAATCTTTTAATTCTGTCAAAAAAACTGCTTGCCCATTTGTATATAGAGTTAAAGTATTACGATAT
TCATTAATACAACGTGCAGGAATATGTCCTGTAAAAATAACTTCATCATTTTTTGATTGACTTGTTTCAATTATTGCACA
ATGTTTTTGTGCATCATTATATGCACGAGAAAAGTATTCCTGTGGTGTAAAAAGTATAAACGAAAGATATGGCTCTAATA
ATTGCGTTCCCGCTTTTTTCAATGTTTGTTCAAGTACAATTGGGGCAAGAAAGCGAAAATCCGAGGGAGTACTAACAGGG
CTATAATAAACACCATATTCAAAACATATTTTACAATCTGTCACTTTCCAACCATACAATCCTTGCTCCAGTCCATAATT
AATACCTTCTCTTACTGCATTTTGGAAACTTTGATTTAAATAACCGAGTGAAACTTTGCTTTCGTACTGTATTCCACTGC
CAATTGGAAGTGGAGTTATTGATAATCCAATTGATGCCCAAAATGGATTTGGTGGTACTTCAATATGAATAGTATAATCT
GCCTTTTGTAATGGCTTTTCCAAATAAATTACGGTTGGATCTTCGATTCTTATGTTTATGTGATATTTTTCAATCAACAG
AGAACAGATAACTTCTAACTGCACTGTTCCTAAAAAAGAAATGATGATTTCATGTGTTATCGTATCAACATAATAACGTA
AAAGAGGATCAGTATCTGCAATTTCTGTAAGAGCATCCAATAATTTTTCTCTCTCTTCTATTTTTATCGGTTCAATTCTT
GTTCGTAGTATTGGTGCAGTATTGTCATTCCATACATTGCATGGCAAAATCTTTTCATTTCCTATAATATCGTTCAATCT
TAATGTATTGTTAGGTATAATAAAAATATCTCCAGAACAAACTATTTTTGTCTGTATCATTTCCCCATTTGAAGGAATAT
ATATTTCTGTAAGTTTCACTTTCTTTTTTTCTGGCAATATAATTGTATCTCGTAAGTGTAATGTTCCACTGTAAAGACGC
AAATAAACTAATCTTTGCTTATGGTCTGTATATTCAATTTTAAAAACTCTTCCACATAGTTCTGAACCATTCTCATTCAT
TTCAGAACAAAAAAGATTTGAAATAGCTTCAATGAGTTGTTGAGTCCCTATATTATTTCTAGCACTTCCATGGTATATAG
GAAACAACGAACCTTTTTTAACACACCTATATTCTTCATACGTTAATTCCTGTATAGTCAATTTTTCTCCTGCAATATAT
TTTTTTAAAAGTTTATCATTTCTGGAAATTACAGGATCCCAATCATCTAAATCAATAATATTTTTAATTGATATTTCTGG
AGTTAATGTTACATTTTGCATAACAATAATATCATTTGAAAGTTTTTCTTTGATATTTTGATAAATATTATTTAAGTTAA
TTCCATCCTGATCTATTTTATTTATAAAAATAATTGTTGGTATATTCATTTTTTGAAGTGCATGGAATAGTATTCGAGTT
TGTGCTTGTACACCATCTTTAGCAGAAATTACTAAAATAGCTCCATCAAGAACAGATAAGGAACGATACACTTCTGTTAT
AAAATCTGTATGTCCAGGAGTATCTACAATATTGATTTTGTAGTCATTCCAATTAAAAGAAGTAACTGCTGCCTGAATTG
TGATTCCACGCTGACGTTCTAAAAACATAGTATCTGTCCTTGTTGTTCCCTTATCTACACTGCCTAATTCTAAAATCGCT
CCACTTGTATAAAGTAGACTTTCCGTTAAGGTCGTCTTTCCTGCATCTACATGAGCAAGAATACCAATGTTGATTATTTT
CAT

>Tet|Tet-44|FN594949|25245-27167|1923|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET44
ATGAAAATAATCAACATTGGTATTCTTGCTCATGTAGATGCAGGAAAGACGACCTTAACGGAAAGTCTGCTTTATACAAG
TGGAGCAATTTTAGAATTAGGCAGTGTAGATAAGGGAACAACAAGGACAGATACTATGTTTTTAGAACGTCAGCGTGGAA
TCACAATTCAGGCAGCAGTTACTTCTTTTAATTGGAATGACTACAAAATCAATATTGTAGATACTCCTGGACATACAGAT
TTTATAACAGAAGTGTATCGTTCCTTATCTGTTCTTGATGGAGCAATTTTAGTAATTTCTGCTAAAGATGGTGTACAAGC
ACAAACCCGAATACTATTCCATGCACTTCAAAAAATGAATATACCAACAATTATTTTTATAAATAAAATAGATCAGGATG
GAATTAACTTAAATAATATTTATCAAAATATCAAAGAAAAACTTTCAAATGATATTATTGTTATGCAAAATGTAACATTA
ACTCCAGAAATATCAATTAAAAATATCATTGATTTAGATGATTGGGATCCTGTAATTTCCAAAAATGATAAACTTTTAGA
AAAATATATTGTAGGAGAAAAATTGACTATACAAGAATTAATGTATGAAGAATATAGGTGTGTTAAAAAAGGTTCGTTGT
TTCCTATATACCATGGAAGTGCTAGAAATAATATAGGGACTCAACAACTTATCGAAGCTATTTCAAATCTTTTTTGTTCT
GAAATGAATGAGAATGATTCAGAACTATGTGGAAGAGTTTTTAAAATTGAATATACAGACCATAAGCAAAGATTAGTTTA
TTTGCGTCTTTATAGTGGAACATTACACTTACGAGATACAATTATATTGCCAGAAAAAAAGAAAGTGAAACTTACAGAAA
TATATATTCCTTCAAATGGAGAAATGATACAGACAAAAACAGTTTGTTCTGGAGATATTTTTATTATACCTAACAATACA
TTAAGATTGAACGATATTATAGGAAATGAAAAGCTTTTGCCATGCAATGTATGGAATGACAAGACTGTACCAATACTACG
AACAAGAATTGAACCGATAAAAATAGAAGAGAGAGAAAAATTATTGGATGCTCTTACAGAAATTGCAGATACTGATCCTC
TTTTACGTTATTATGTTGATACGATAACACATGAAATCATCATTTCTTTTTTAGGAACAGTGCAGTTAGAAGTTATCTGT
TCTCTGTTGATTGAAAAATATCACATAAACATAAGAATCGAAGATCCAACCGTAATTTATTTGGAAAAACCATTACAAAA
GGCAGATTATACTATTCATATTGAAGTACCACCAAATCCATTTTGGGCATCGATTGGATTATCAATAACTCCACTTCCAA
TTGGCAGTGGAATACAGTACGAAAGCAAAGTTTCACTCGGTTATTTAAATCAAAGTTTCCAAAATGCAGTAAGAGAAGGT
ATTAATTATGGACTGGAGCAAGGTTTGTATGGTTGGGAAGTAACAGATTGTAAAATATGTTTTGAATATGGTGTTTATTA
TAGCCCTGTTAGTACTCCCTCGGATTTTCGCTTTCTTGCCCCAATTGTACTTGAACAAACATTGAAAAAAGCGGGAACGC
AATTATTAGAGCCATATCTTTCGTTTATACTTTTTACGCCACAGGGATACTTTTCTCGTGCATATAAAGATGCACAAAAA
CATTGTGCAATAATTGAAACAAGTCAATCAAAAAATGATGAAGTTATTTTTACAGGACATATTCCTGTACGTTGTATTAA
TGAATATCGTAATACTTTAACTCTATATACAAATGGGCAAGCAGTTTTTTTGACAGAATTAAAAGATTATCAAATTGCTA
CTTGTGAACCAGTTATTCAATCACGTAGACCAAATAATCGAATAGATAAAGTACGCCATATGTTTAATAAAAAAGAAAAT
TAA