MEGAResFrom MEG, the Microbial Ecology Group

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

TET40

The tet40 gene encodes a tetracycline ribosomal protection protein.

References

  • http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2573101/

Notice: Trying to access array offset on value of type null in /home/meglabuser/megares.meglab.org/vendor/doctrine/annotations/lib/Doctrine/Common/Annotations/DocParser.php on line 967

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>>MEG_6991|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET40
atgtttgctaaaaattcaaaggcatattctgtctacctgctgttccgatttgtctgttccctggcggtttctatgtccac
agtgctttccatcgtgtaccacctggaggtggtgcagctggatgctttccagcttgtcctggtagggacggttctggaga
cctcctgctttctgttcgagatacccaccggtgtggtggcggatttgtatagccgtcggcgctcggtgctgattggaatg
ttcctctacggcctgggctttctgatggagggtgcgctaccgtggttcgcgccggttctgctggcccaggttgtctgggg
ttgcggtgataccttcatcaccggcgctctggaggcgtggattgcctcggaggaagaggacaaacccatagacaaggtgt
tcctgcggggcagtcaaatggggcaaatcggcggcgttctgggcgtggtgctgggcacactgctgggaaacataaacctg
caaatgcctgtcatcttggggggcagtttgtgcttgttgttggggctggtgttggttcgcatcatgccagaaaccaactt
ctcccctgctattgaggaacggcagggcttgcttaaagactttgtctgcctgttcaagctcaacctgggctttgtgaaag
gcgcacctgtgttgctggcgctcttagcaatcacactatgcgggggacttgccagtgaaggctttgaccggctctccacc
gctcattttctggatgacacggtaatacccgttatcgggccgctgaacagcgtcacttggttcggtgttatcagtcttat
cggcagcggcttaggtattctggcttctcagttgctcatcgcccgcatggagaaaaaagggactgtcagccgaaccagtg
tggtcatgtccaccagcgccgggtatatcctgtgcctggttctcttcgcggtggggcggagcttttggttcatgttgttg
gtgttcctgctggcggggcttatgcgcaccatcaaggagcctgtgctggccgcctggatgaacgaccatgtggatgagaa
aatgcgcgccacagtcttttccaccagcggacagctggactctttcgggcagatcatcggcgggcctattgtggggctgg
tagcccagcaggtgtccataccctgggggctggtctgtaccgctttcctgctgttgcccgcgctgttcttagtgccggtg
gcgggaaagaagcgggattga

>>MEG_6992|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET40
ATGTTTGCTAAAAATTCAAAGGCATATTCTGTCTACCTGCTGTTCCGATTTGTCTGTTCCCTGGCGGTTTCTATGTCCAC
AGTGCTTTCCATCGTGTACCACCTGGAGGTGGTGCAGCTGGATGCTTTCCAGCTTGTCCTGGTAGGGACGGTTCAGGAGG
CCTCCTGCTTTCTGTTCGAGATGCCCACCGGTGTGGTGGCGGATTTGTATAGCCGTCGGCGCTCGGTGCTGATTGGAATG
TTCCTCTACGGCCTGGGCTTTCTGATGGAGGGTGCGCTACCGTGGTTCGCGCCGGTTCTGCTGGCCCAGGTTGTCTGGGG
TTGCGGTGATACCTTCATCACCGGCGCTCTGGAGGCGTGGATTGCCTCGGAGGAAGAGGACAAACCCATAGACAAGGTGT
TCCTGCGGGGCAGTCAAATGGGGCAAATCGGCGGCGTTCTGGGCGTGGTGCTGGGCACACTGCTGGGAAACATAAACCTG
CAAATGCCTCTCATCTTGGGGGGCAGTTTGTGCTTGTTGTTGGGGCTGGTGATGGTTCGCATCATGCCAGAAACCAACTT
CTCCCCTGCTATTGAGGAACGGCAGGGCTTGCTTAAAGACTTTGTCTGCCTGTTCAAGCTCAACCTGGGCTTTGTGAAAG
GCGCACCTGTGTTGCTGGCGCTCTTAGCAATCACACTATGCGGGGGACTTGCCAGTGAAGGCTTTGACCGGCTCTCCACC
GCTCATTTTCTGGATGACACGGTAATACCCGTTATCGGGCCGCTGAACAGCGTCACTTGGTTCGGTGTTATCAGTCTTAT
CGGCAACGGCTTAGGTATTCTGGCTTCTCAGTTGCTCATCGCCCGCATGGAGAAAAAAGGGACTGTCAGCCGAACCAGTG
TGGTCATGTCCACCAGCGCCGGGTATATCCTGTTCCTGGTTCTCTTCGCGGTGGGGCGGAGCTTTTGGTTCATGTTGTTG
GTGTTCCTGCTGGCGGGGCTTATGCGCACCATCAAGGAGCCTGTGCTGGCCGCCTGGATGAACGACCATGTGGATGAGAA
AATGCGCGCCACAGTCTTTTCCACCAGCGGACAGCTGGACTCTTTCGGGCAGATCATCGGCGGGCCTATTGTGGGGCTGG
TAGCCCAGCAGGTGTCCATACCCTGGGGGCTGGTCTGTACCGCTTTCCTGCTGTTGCCCGCGCTGTTCTTAGTGCCGGTG
GCGGGAAAGAAGCGGGATTGA

>>MEG_6993|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET40
ATGTTTGCTAAAAATTCAAAGGCATATTCTGTCTACCTGCTGTTCCGATTTGTCTGTTCCCTGGCGGTTTCTATGTCCAC
AGTGCTTTCCATCGTGTACCACCTGGAGGTGGTGCAGCTGGATGCTTTCCAGCTTGTCCTGGTAGGGACGGTTCAGGAGA
CCTCCTGCTTTCTGTTCGAGATGCCCACCGGTGTGGTGGCGGATTTGTATAGCCGTCGGCGCTCGGTGCTGATTGGAATG
TTCCTCTACGGCCTGGGCTTTCTGATGGAGGGTGCGCTACCGTGGTTCGCGCCGGTTCTGCTGGCCCAGGTTGTCTGGGG
TTGCGGTGATACCTTCATCACCGGCGCTCTGGAGGCGTGGATTGCCTCGGAGGAAGAGGACAAACCCATAGACAAGGTGT
TCCTGCGGGGCAGTCAAATGGGGCAAATCGGCGGCGTTCTGGGCGTGGTGCTGGGCACACTGCTGGGAAACATAAACCTG
CAAATGCCTCTCATCTTGGGGGGCAGTTTGTGCTTGTTGTTGGGGCTGGTGATGGTTCGCATCATGCCAGAAACCAACTT
CTCCCCTGCTATTGAGGAACGGCAGGGCTTGCTTAAAGACTTTGTCTGCCTGTTCAAGCTCAACCTGGGCTTTGTGAAAG
GCGCACCTGTGTTGCTGGCGCTCTTAGCAATCACACTATGCGGGGGACTTGCCAGTGAAGGCTTTGACCGGCTCTCCACC
GCTCATTTTCTGGATGACACGGTAATACCCGTTATCGGGCCGCTGAACAGCGTCACTTGGTTCGGTGTTATCAGTCTTAT
CGGCAACGGCTTAGGTATTCTGGCTTCTCAGTTGCTCATCGCCCGCATGGAGAAAAAAGGGACTGTCAGCCGAACCAGTG
TGGTCATGTCCACCAGCGCCGGGTATATCCTGTTCCTGGTTCTCTTCGCGGTGGGGCGGAGCTTTTGGTTCATGTTGTTG
GTGTTCCTGCTGGCGGGGCTTATGCGCACCATCAAGGAGCCTGTGCTGGCCGCCTGGATGAACGACCATGTGGATGAGAA
AATGCGCGCCACAGTCTTTTCCACCAGCGGACAGCTGGACTCTTTCGGGCAGATCATCGGCGGGCCTATTGTGGGGCTGG
TAGCCCAGCAGGTGTCCATACCCTGGGGGCTGGTCTGTACCGCTTTCCTGCTGTTGCCCGCGCTGTTCTTAGTGCCGGTG
GCGGGAAAGAAGCGGGATTGA

>>MEG_6994|Drugs|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET40
ATGTTTGCTAAAAATTCAAAGGCATATTCTGTCTACCTGCTGTTCCGATTTGTCTGTTCCCTGGCGGTTTCTATGTCCAC
AGTGCTTTCCATCGTGTACCACCTGGAGGTGGTGCAGCTGGATGCTTTCCAGCTTGTCCTGGTAGGGACGGTTCTGGAGA
CCTCCTGCTTTCTGTTCGAGATACCCACCGGTGTGGTGGCGGATTTGTATAGCCGTCGGCGCTCGGTGCTGATTGGAATG
TTCCTCTACGGCCTGGGCTTTCTGATGGAGGGTGCGCTACCGTGGTTCGCGCCGGTTCTGCTGGCCCAGGTTGTCTGGGG
TTGCGGTGATACCTTCATCACCGGCGCTCTGGAGGCGTGGATTGCCTCGGAGGAAGAGGACAAACCCATAGACAAGGTGT
TCCTGCGGGGCAGTCAAATGGGGCAAATCGGCGGCGTTCTGGGCGTGGTGCTGGGCACACTGCTGGGAAACATAAACCTG
CAAATGCCTGTCATCTTGGGGGGCAGTTTGTGCTTGTTGTTGGGGCTGGTGATGGTTCGCATCATGCCAGAAACCAACTT
CTCCCCTGCTATTGAGGAACGGCAGGGCTTGCTTAAAGACTTTGTCTGCCTGTTCAAGCTCAACCTGGGCTTTGTGAAAG
GCGCACCTGTGTTGCTGGCGCTCTTAGCAATCACACTATGCGGGGGACTTGCCAGTGAAGGCTTTGACCGGCTCTCCACC
GCTCATTTTCTGGATGACACGGTAATACCCGTTATCGGGCCGCTGAACAGCGTCACTTGGTTCGGTGTTATCAGTCTTAT
CGGCAACGGCTTAGGTATTCTGGCTTCTCAGTTGCTCATCGCCCGCATGGAGAAAAAAGGGACTGTCAGCCGAACCAGTG
TGGTCATGTCCACCAGCGCCGGGTATATCCTGTGCCTGGTTCTCTTCGCGGTGGGGCGGAGCTTTTGGTTCATGTTGTTG
GTGTTCCTGCTGGCGGGGCTTATGCGCACCATCAAGGAGCCTGTGCTGGCCGCCTGGATGAACGACCATGTGGATGAGAA
AATGCGCGCCACAGTCTTTTCCACCAGCGGACAGCTGGACTCTTTCGGGCAGATCATCGGCGGGCCTATTGTGGGGCTGG
TAGCCCAGCAGGTGTCCATACCCTGGGGGCTGGTCTGTACCGCTTTCCTGCTGTTGCCCGCGCTGTTCTTAGTGCCGGTG
GCGGGAAAGAAGCGGGATTGA