MEGAResFrom MEG, the Microbial Ecology Group

TET40

The tet40 gene encodes a tetracycline ribosomal protection protein.

References

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>Tet|JQ740052.1|gene2|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET40
ATGTTTGCTAAAAATTCAAAGGCATATTCTGTCTACCTGCTGTTCCGATTTGTCTGTTCCCTGGCGGTTTCTATGTCCAC
AGTGCTTTCCATCGTGTACCACCTGGAGGTGGTGCAGCTGGATGCTTTCCAGCTTGTCCTGGTAGGGACGGTTCTGGAGA
CCTCCTGCTTTCTGTTCGAGATACCCACCGGTGTGGTGGCGGATTTGTATAGCCGTCGGCGCTCGGTGCTGATTGGAATG
TTCCTCTACGGCCTGGGCTTTCTGATGGAGGGTGCGCTACCGTGGTTCGCGCCGGTTCTGCTGGCCCAGGTTGTCTGGGG
TTGCGGTGATACCTTCATCACCGGCGCTCTGGAGGCGTGGATTGCCTCGGAGGAAGAGGACAAACCCATAGACAAGGTGT
TCCTGCGGGGCAGTCAAATGGGGCAAATCGGCGGCGTTCTGGGCGTGGTGCTGGGCACACTGCTGGGAAACATAAACCTG
CAAATGCCTGTCATCTTGGGGGGCAGTTTGTGCTTGTTGTTGGGGCTGGTGTTGGTTCGCATCATGCCAGAAACCAACTT
CTCCCCTGCTATTGAGGAACGGCAGGGCTTGCTTAAAGACTTTGTCTGCCTGTTCAAGCTCAACCTGGGCTTTGTGAAAG
GCGCACCTGTGTTGCTGGCGCTCTTAGCAATCACACTATGCGGGGGACTTGCCAGTGAAGGCTTTGACCGGCTCTCCACC
GCTCATTTTCTGGATGACACGGTAATACCCGTTATCGGGCCGCTGAACAGCGTCACTTGGTTCGGTGTTATCAGTCTTAT
CGGCAGCGGCTTAGGTATTCTGGCTTCTCAGTTGCTCATCGCCCGCATGGAGAAAAAAGGGACTGTCAGCCGAACCAGTG
TGGTCATGTCCACCAGCGCCGGGTATATCCTGTGCCTGGTTCTCTTCGCGGTGGGGCGGAGCTTTTGGTTCATGTTGTTG
GTGTTCCTGCTGGCGGGGCTTATGCGCACCATCAAGGAGCCTGTGCTGGCCGCCTGGATGAACGACCATGTGGATGAGAA
AATGCGCGCCACAGTCTTTTCCACCAGCGGACAGCTGGACTCTTTCGGGCAGATCATCGGCGGGCCTATTGTGGGGCTGG
TAGCCCAGCAGGTGTCCATACCCTGGGGGCTGGTCTGTACCGCTTTCCTGCTGTTGCCCGCGCTGTTCTTAGTGCCGGTG
GCGGGAAAGAAGCGGGATTGA

>Tet|tet40_2_FJ158002|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET40
ATGTTTGCTAAAAATTCAAAGGCATATTCTGTCTACCTGCTGTTCCGATTTGTCTGTTCCCTGGCGGTTTCTATGTCCAC
AGTGCTTTCCATCGTGTACCACCTGGAGGTGGTGCAGCTGGATGCTTTCCAGCTTGTCCTGGTAGGGACGGTTCTGGAGA
CCTCCTGCTTTCTGTTCGAGATACCCACCGGTGTGGTGGCGGATTTGTATAGCCGTCGGCGCTCGGTGCTGATTGGAATG
TTCCTCTACGGCCTGGGCTTTCTGATGGAGGGTGCGCTACCGTGGTTCGCGCCGGTTCTGCTGGCCCAGGTTGTCTGGGG
TTGCGGTGATACCTTCATCACCGGCGCTCTGGAGGCGTGGATTGCCTCGGAGGAAGAGGACAAACCCATAGACAAGGTGT
TCCTGCGGGGCAGTCAAATGGGGCAAATCGGCGGCGTTCTGGGCGTGGTGCTGGGCACACTGCTGGGAAACATAAACCTG
CAAATGCCTGTCATCTTGGGGGGCAGTTTGTGCTTGTTGTTGGGGCTGGTGATGGTTCGCATCATGCCAGAAACCAACTT
CTCCCCTGCTATTGAGGAACGGCAGGGCTTGCTTAAAGACTTTGTCTGCCTGTTCAAGCTCAACCTGGGCTTTGTGAAAG
GCGCACCTGTGTTGCTGGCGCTCTTAGCAATCACACTATGCGGGGGACTTGCCAGTGAAGGCTTTGACCGGCTCTCCACC
GCTCATTTTCTGGATGACACGGTAATACCCGTTATCGGGCCGCTGAACAGCGTCACTTGGTTCGGTGTTATCAGTCTTAT
CGGCAACGGCTTAGGTATTCTGGCTTCTCAGTTGCTCATCGCCCGCATGGAGAAAAAAGGGACTGTCAGCCGAACCAGTG
TGGTCATGTCCACCAGCGCCGGGTATATCCTGTGCCTGGTTCTCTTCGCGGTGGGGCGGAGCTTTTGGTTCATGTTGTTG
GTGTTCCTGCTGGCGGGGCTTATGCGCACCATCAAGGAGCCTGTGCTGGCCGCCTGGATGAACGACCATGTGGATGAGAA
AATGCGCGCCACAGTCTTTTCCACCAGCGGACAGCTGGACTCTTTCGGGCAGATCATCGGCGGGCCTATTGTGGGGCTGG
TAGCCCAGCAGGTGTCCATACCCTGGGGGCTGGTCTGTACCGCTTTCCTGCTGTTGCCCGCGCTGTTCTTAGTGCCGGTG
GCGGGAAAGAAGCGGGATTGA

>Tet|Tet-40|AM419751|14211-15431|1221|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET40
ATGTTTGCTAAAAATTCAAAGGCATATTCTGTCTACCTGCTGTTCCGATTTGTCTGTTCCCTGGCGGTTTCTATGTCCAC
AGTGCTTTCCATCGTGTACCACCTGGAGGTGGTGCAGCTGGATGCTTTCCAGCTTGTCCTGGTAGGGACGGTTCAGGAGG
CCTCCTGCTTTCTGTTCGAGATGCCCACCGGTGTGGTGGCGGATTTGTATAGCCGTCGGCGCTCGGTGCTGATTGGAATG
TTCCTCTACGGCCTGGGCTTTCTGATGGAGGGTGCGCTACCGTGGTTCGCGCCGGTTCTGCTGGCCCAGGTTGTCTGGGG
TTGCGGTGATACCTTCATCACCGGCGCTCTGGAGGCGTGGATTGCCTCGGAGGAAGAGGACAAACCCATAGACAAGGTGT
TCCTGCGGGGCAGTCAAATGGGGCAAATCGGCGGCGTTCTGGGCGTGGTGCTGGGCACACTGCTGGGAAACATAAACCTG
CAAATGCCTCTCATCTTGGGGGGCAGTTTGTGCTTGTTGTTGGGGCTGGTGATGGTTCGCATCATGCCAGAAACCAACTT
CTCCCCTGCTATTGAGGAACGGCAGGGCTTGCTTAAAGACTTTGTCTGCCTGTTCAAGCTCAACCTGGGCTTTGTGAAAG
GCGCACCTGTGTTGCTGGCGCTCTTAGCAATCACACTATGCGGGGGACTTGCCAGTGAAGGCTTTGACCGGCTCTCCACC
GCTCATTTTCTGGATGACACGGTAATACCCGTTATCGGGCCGCTGAACAGCGTCACTTGGTTCGGTGTTATCAGTCTTAT
CGGCAACGGCTTAGGTATTCTGGCTTCTCAGTTGCTCATCGCCCGCATGGAGAAAAAAGGGACTGTCAGCCGAACCAGTG
TGGTCATGTCCACCAGCGCCGGGTATATCCTGTTCCTGGTTCTCTTCGCGGTGGGGCGGAGCTTTTGGTTCATGTTGTTG
GTGTTCCTGCTGGCGGGGCTTATGCGCACCATCAAGGAGCCTGTGCTGGCCGCCTGGATGAACGACCATGTGGATGAGAA
AATGCGCGCCACAGTCTTTTCCACCAGCGGACAGCTGGACTCTTTCGGGCAGATCATCGGCGGGCCTATTGTGGGGCTGG
TAGCCCAGCAGGTGTCCATACCCTGGGGGCTGGTCTGTACCGCTTTCCTGCTGTTGCCCGCGCTGTTCTTAGTGCCGGTG
GCGGGAAAGAAGCGGGATTGA

>Tet|tet40_1_FJ158002|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET40
ATGTTTGCTAAAAATTCAAAGGCATATTCTGTCTACCTGCTGTTCCGATTTGTCTGTTCCCTGGCGGTTTCTATGTCCAC
AGTGCTTTCCATCGTGTACCACCTGGAGGTGGTGCAGCTGGATGCTTTCCAGCTTGTCCTGGTAGGGACGGTTCAGGAGA
CCTCCTGCTTTCTGTTCGAGATGCCCACCGGTGTGGTGGCGGATTTGTATAGCCGTCGGCGCTCGGTGCTGATTGGAATG
TTCCTCTACGGCCTGGGCTTTCTGATGGAGGGTGCGCTACCGTGGTTCGCGCCGGTTCTGCTGGCCCAGGTTGTCTGGGG
TTGCGGTGATACCTTCATCACCGGCGCTCTGGAGGCGTGGATTGCCTCGGAGGAAGAGGACAAACCCATAGACAAGGTGT
TCCTGCGGGGCAGTCAAATGGGGCAAATCGGCGGCGTTCTGGGCGTGGTGCTGGGCACACTGCTGGGAAACATAAACCTG
CAAATGCCTCTCATCTTGGGGGGCAGTTTGTGCTTGTTGTTGGGGCTGGTGATGGTTCGCATCATGCCAGAAACCAACTT
CTCCCCTGCTATTGAGGAACGGCAGGGCTTGCTTAAAGACTTTGTCTGCCTGTTCAAGCTCAACCTGGGCTTTGTGAAAG
GCGCACCTGTGTTGCTGGCGCTCTTAGCAATCACACTATGCGGGGGACTTGCCAGTGAAGGCTTTGACCGGCTCTCCACC
GCTCATTTTCTGGATGACACGGTAATACCCGTTATCGGGCCGCTGAACAGCGTCACTTGGTTCGGTGTTATCAGTCTTAT
CGGCAACGGCTTAGGTATTCTGGCTTCTCAGTTGCTCATCGCCCGCATGGAGAAAAAAGGGACTGTCAGCCGAACCAGTG
TGGTCATGTCCACCAGCGCCGGGTATATCCTGTTCCTGGTTCTCTTCGCGGTGGGGCGGAGCTTTTGGTTCATGTTGTTG
GTGTTCCTGCTGGCGGGGCTTATGCGCACCATCAAGGAGCCTGTGCTGGCCGCCTGGATGAACGACCATGTGGATGAGAA
AATGCGCGCCACAGTCTTTTCCACCAGCGGACAGCTGGACTCTTTCGGGCAGATCATCGGCGGGCCTATTGTGGGGCTGG
TAGCCCAGCAGGTGTCCATACCCTGGGGGCTGGTCTGTACCGCTTTCCTGCTGTTGCCCGCGCTGTTCTTAGTGCCGGTG
GCGGGAAAGAAGCGGGATTGA