MEGAResFrom MEG, the Microbial Ecology Group

TET36

The tet36 gene encodes a tetracycline ribosomal protection protein.

References

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>49|AJ514254.1|AJ514254|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET36
ATGAGAACTATAAATATAGGTATTCTTGCACATATTGATGCAGGAAAGACCTCCATTACAGAGAACTTGCTATTTGCGAG
TGGAGCAACCATAGTACGTGGAAGTGTGGACAAAGGAAACACTACAACCGATTCGATGGATATCGAAAAACGAAGAGGTA
TCACAGTTAGAGCGTCTACAACATCTATTCAATGGAATGATACAAAGATTAATATCATCGACACTCCTGGACACATGGAC
TTTCTGGCAGAGGTAGAACGCACTTTTAGGATGCTAGATGGTGCTATACTTGTGGTGTCTGCCAAAGAGGGCATTCAAGC
TCAAACAAGGTTGTTGTTCAATGTCCTGCAACAACTAGAAATACCTACAATTCTATTCGTCAACAAAATAGACAGAGAGG
GAGTCAATCTAAATCAGCTTTATTTAGAGATACAAAATAGCCTTTCTAAAGATATTATCTTTATGCAATCCGTTGAAGGC
AAGGAATTAACATCTAGCTGTACAATACACTACATATCAGAAAAGAACAGAGAAACAATTTTAGAGAAAGATGATCTCTT
GCTTGAAAAATACTTGAGTGATACACAGCTTTCTAATTTAGATTATTGGAATTCAATGGTTCGTCTTGTTCAAGCTGCTA
AATTACATCCTATCTATCATGGTTCAGCAATGTATGGCATTGGTATTGAAGATTTGCTAAACTCAATCACTACTTTTATC
GAAACATCTCTACCTCAAGAGAACGCTTTGTCTGCCTATGTTTATAAAATTGAGCATAATAAGAAGGAACAGAAACGAGC
CTATCTAAAGATTATAGGTGGAACCCTTAAATCTCGAAAATTATATAGCCTCAATGGCTCAGATGAGAATCTGAAGATAA
GAGGTTTAAAGACCTTTTACTCAGGAGACGAAATAGATGTAGACGAAGTTTTTACAAATGATATTGCAATTGCAGATCAT
GCTGATAACTTAATGGTAGGAGATTATCTAGGAATAATGCCAAACTTATTCGACAAATTGAATATTCCTAGTCCTGCTCT
CAAATCGTCTATACATCCTGCAAAAGTAGAGAATAGGAGTAAATTGATTTCTGCTATGAATGTATTATCAGTAGAAGATC
CATCTTTGGCCTTTAGCATTAATGCTGATAATAATGAATTGGAGGTTTCGCTTTATGGAGCAACTCAACGGGAGGTGATT
TTGACTTTATTGGAAGAGAGATTTTCGGTAGATGCTTACTTTGAAGAGGTGAAAACTATCTATAAAGAACGTCTTAAAAC
AAAATCGGAATACACCATTCATATCGAAGTGCCACCTAATCCGTATTGGGCATCTATTGGCTTGATTATAGAGCCTTTGC
CAATTGGGGCGGGACTTGTAATGGAGAGTGAAATATCATTGGGATATTTGAATCGATCCTTTCAGAATGCAGTATTCGAT
GGAGTCAAGAAAGCCTGTGAATCGGGTTTGTACGGTTGGGAAGTAACTGACCTTAAAGTCACTTTTTCTCACGGAATCTA
TTATAGCCCAGTGAGTACACCTGCCGACTTTAGAAGTTTAGCACCTTATGTTTTTCGATTAGCTTTGCAACAAGCTGATG
TTGAGTTATTGGAGCCAATCTTAGATTTTAAATTGCAAATTCCACTAGCTGTGAATGCTAGAGCTATTACAGACATCAAC
AAGATGCAAGGCGAAATATCTACTATTACTTCAGATGGTGATTGGACTACTATTTTGGGTAATATTCCTTTAGATACTAG
TAAAGAATACTCAGCAGAGGTCAGTTCCTACACACAAGGCTTGGGCGTTTTTGTTACTCGATTTTCGGGTTATCGACCTA
CCAACAAAAAGGTAAGCAGAAGTGTAGAACTGAATGAAAAAGATAAGCTGATGTATATGTTTGAGAAGGAAAGTATCAAA
TAA