MEGAResFrom MEG, the Microbial Ecology Group

TET32

The tet32 gene encodes a tetracycline ribosomal protection protein.

References

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>Tet|Tet-32|DQ647324|181-2100|1920|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET32
ATGAAAATAATCAATATTGGAATTCTCGCCCATGTAGACGCAGGAAAAACAACATTGACGGAAAGCCTGCTGTACACCAG
TGGAGCGATTGCGGAACAAGGAAACGTGGATAAAGGAACTACAAGAACAGACACTATGATTTTGGAACGGCAGCGCGGAA
TTACCATTCAGACAGCGGTTACTTCTTTTTGCTGGAATGATTATAAAATCAATATCGTGGACACTCCCGGTCATATGGAT
TTTTTAACCGAAGCATACCGCTCTTTATCTGTCCTTGACGGAGCTGTTTTAGTCATTTCGGCAAAAGACGGCGTACAGGC
ACAAACCCGTATATTATTCCATGCGCTTCAGAAAATGGACATTCCGACAATTATCTTTATAAATAAGATAGACCAAAATG
GGATCGACCTGCGGCGTGTTTACCAAAGCATTAAAGATAAACTTACCAGTGATATGATTGTCATGCAGGAGGTTTCCCTG
TCGCCAAAGATAACCATGACCGATATTTCTGATTTGGACAAATGGGATATGATTATTTCCGGAAGCGATGAACTATTAGA
ACGATATGTTGCAGAGGATTCTTTGGATATACAGGAATTACAATATGAAAAGTGCAAAAGAACCAGATGCTGCTCTTTGT
TTCCTGTTTATCATGGGAGTGCAAAAGACAATTTAGGAACAGAAAAACTGATTGAAGCGATTACAGAAACTTTCATTACA
GAAACAGACGATATTCAGTCTGAATTATGTGGATATGTTTTTAAGGTTGAGTATACAGAGCGGAAAAAACGGCTTTCTTA
TTTACGCCTGTATCATGGGACGCTCCATTTACGGGATACCCTGCTGCTGTCAAAAAAGGAAAAAATAAAGATTACAGAAA
TGTGTATTCCGTCAAATGGTGAAATCGTCCCGGTTGACCATGCCTGTCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTGGGAAATGAAAAACTCCTGCCTCACAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCACAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACACATGAGATTATATTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGCTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCAAAAAAA
AGCGAGCTACACGATTCATATTGAAGTGCCGCCGAATCCGTTTTGGGCATCTATTGGTTTGACTGTAACACCGCTTCCTG
TTGGAAGCGGAACACAATATAAAAGCGAGGTATCTCTCGGCTATTTAAACCAAAGTTTTCAAAATGCCGTCATGGAGGGT
GTGCGTTATGGAATGGAGCAGGGCTTATATGGCTGGGGAGTGACAGACTGCCAAATTTGTTTTGATTATGGAGTTTATTA
CAGCCCGGTCAGCACCCCCGCTGATTTTCGTTTTCTTGCGCCTGTCGTGTTGGAGCAGGCATTGAAAAAAGCAGGAACAC
AACTGTTGGAACCATACCTTTCCTTTACCCTTTTTGCACCGCAGGAATATCTTTCACGGGCTTATAATGACGCACCAAAG
TATTGCGCAATCATTGAATCAACCAGACTTGAAAAAGATGAAGTTATTTTTAAGGGGGAAATCCCTGCCCGTTGTATTGG
TGAATATAGAAATGATTTGAATTTTTATACAAATGGAAGAAGTGTCTGCATTACAGAATTAAAAGGGTATCAGGAAACTT
CCGGCGAGCCTGTGTTTCAGCCACGCCGCCCGAACAGCCGTTTAGACAAGATCCGGCATATGTTTCAGAAGATAATGTAA

>Tet|AJ295238|gene|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET32
ATGAAAATAATTAACTTAGGCATTCTGGCTCACGTTGACGCAGGAAAGACAACATTAACGGAAAGTTTATTGTATACCAG
TGGTGCAATTGCAGAACTAGGGAGCGTAGATGAAGGCACAACAAGGACAGATACAATGAATTTGGAGCGTCAAAGGGGAA
TCACTATCCAGACAGCAGTGACATCTTTTCAGTGGGAGGATGTAAAAGTCAACATTATAGATACGCCAGGCCATATGGAT
TTTTTAACCGAAGCATACCGCTCTTTATCTGTCCTTGACGGAGCTGTTTTAGTCATTTCGGCAAAAGACGGCGTACAGGC
ACAGACGCGTATATTATTCCATGCGCTTCAGAAAATGAACATTCCGACAATTATCTTTATAAATAAGATAGACCAAAATG
GAATCGACCTACAGCGTGTTTACCAAAGCATTAAAGACAAACTTACCAGTGATATGATTGTCATGCAGGAGGTTTCCCTG
TCGCCAAAGATAACCATGACCGATATTTCTGATTTGGACAAATGGGATATGATTATTTCCGGAAGCGATGAACTATTAGA
ACGATATGTTGCAGAGGATTCTTTGGATATACAGGAATTACAATATGAAAAGTGCAAAAGAACCAGATGCTGCTCTTTGT
TTCCTGTTTATCATGGGAGTGCAAAAGACAATTTAGGAACAGAAAAACTGATTGAAGCGATTACAGAAACTTTCATTACA
GAAACAGACGATATTCAGTCTGAATTATGTGGATATGTTTTTAAGGTTGAGTATACAGAGCGGAAAAAACGGCTTTCTTA
TTTACGCCTGTATCATGGGACGCTCCATTTACGGGATACCCTGCTGCTGTCAAAAAAGGAAAAAATAAAGATTACAGAAA
TGTGTATTCCGTCAAATGGTGAAATCGTCCCGGTTGACCATGCCTGTCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGACATTCTGGGAAATGAAAAACTCCTGCCTCACAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCACAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACACATGAGATTATATTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGCTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCTTAGAAA
AGCAGAATATACCATCCACATAGAAGTCCCGCCAAATCCTTTCTGGGCTTCTGTCGGGTTGTCCATAGAGCCGCTCCCTA
TTGGAAGCGGAGTGCAGTATGAAAGCAGAGTTTCACTTGGATATTTAAATCAATCGTTCCAAAATGCGGTTATGGAGGGG
GTTCTTTATGGCTGCGAGCAGGGGCTGTATGGATGGAAAGTGACAGACTGTAAAATCTGTTTTGAATATGGATTGTATTA
TAGTCCTGTAAGTACCCCCGCAGACTTTCGGCTGCTTTCCCCTATCGTATTGGAGCAGGCTTTAAAAAAAGCAGGGACAG
AACTATTAGAGCCATATCTCCACTTTGAAATTTATGCACCGCAGGAATATCTCTCACGGGCGTATCATGATGCTCCAAGG
TATTGTGCAGATATTGTAAGTACTCAGATAAAGAATGACGAGGTCATTCTGAAAGGAGAAATCCCTGCTAGATGTATTCA
AGAATACAGGAACGATTTAACTTATTTCACAAATGGGCAGGGAGTCTGCTTGACAGAGTTAAAAGGATACCAGCCAGCTA
TTGGTAAATTTATTTGCCAACCCCGCCGCCCGAATAGCCGTATAGATAAGGTTCGGCATATGTTCCACAAGTTAGCTTAA

>Tet|tet32_1_EU722333|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|TET32
ATGAAAATAATCAATATCGGCATTCTGGCCCATGTAGACGCAGGAAAAACTACATTGACAGAAAGTCTGCTATACACCAG
TGGAGCGATTGCGGAACAGGGAAACGTGGATAAAGGGACCACAAGAACAGACACTATGATTTTGGAACGGCAACGGGGAA
TTACCATTCAGACAGCGGTTACTTCTTTTTATTGGAATGATTATAAAATCAATATCGTGGACACTCCCGGTCATATGGAT
TTTTTAACCGAAGCATACCGCTCTTTATCTGTCCTTGACGGAGCTGTTTTAGTCATTTCAGCAAAAGACGGCGTACAGGC
ACAAACCCGTATATTATTCCATGCGCTTCAGAAAATGGACATTCCGACAATTATCTTTATAAATAAGATAGACCAAAATG
GGATCGACCTGCAGTGTGTTTACCAAAGCATTAAAGATAAACTTACCAGTGATATGATTGTCATGCAGGAGGTTTCCCTG
TCGCCAAAGATAACCATGACCGATATTTCTGATTTAGACAAATGGGATATGATTATTTCCGGAAGCGATGAACTATTAGA
ACGATATGTTGCAGAGGATTCTTTGGATATACAGGAATTACAATATGAAAAGTGCAAAAGAACCAGATGCTGCTCTTTGT
TTCCTGTTTATCATGGGAGTGCAAAAGACAATTTAGGAACAGAAAAACTGATTGAAGCGATTATAGAAACTTTCATTACA
GAAACGGACGATATTCAGTCTGAATTATGTGGATATGTTTTTAAGGTTGAGTATACAGAGCGGAAAAAACGGCTTTCTTA
TTTACGCCTGTATCATGGGACGCTCCATTTACGGGATACCCTGCTGCTGTCAAAAAAGGAAAAAATAAAGATTACAGAAA
TGTGTATTCCGTCAAATGGTGAAATCGTCCCGGCTGACCATGCCTGTCCGGGAGAAATTGTTATTTTAGCTGATGATACT
TTGAAACTGAACGATATCCTGGGAAATGAAAAACTCCTGCCTCACAAAACACGGATTGATAATCCCATGCCATTACTTCG
GACAACGGTAGAGCCGCAAAAGCCGGAGCAAAGGGAAGCCCTGTTAAATGCCCTCGCAGAGATTGCTGATACAGACCCTC
TTTTGCATTTTGACATTGATACTGTTACCCATGAGATTATGTTATCTTTTTTGGGAAAAGTACAGTTAGAAGTTATTTGT
TCGCTATTAGAAGAAAAATATCATGTGGGCGTGGCTATGAAAGAGCCTTCGGTTATTTATCTGGAAAGACCGCAAAAAAA
AGCGAGCTGCACGATTCATATTGAAGTGCCGCCGAATCCGTTTTGGGCATCTATTGGTTTGACTGTAACACCGCTTCCTG
TTGGAAGCGGAACACAATATAAAAGCGAGGTATCTCTCGGCTATTTAAACCAAAGTTTTCAAAATGCCGTCATGGAGGGT
GTGCGTTATGGAATGGAGCAGGGCTTATATGGCTGGGGAGTGACAGACTGCCAAATTTGTTTTGATTATGGAGTTTATTA
CAGCCCGGTCAGCACCCCCGCTGATTTTCGTTTTCTTGCGCCTGTCGTGTTGGAGCAGGCATTGAAAAAAGCAGGGACAC
AACTGTTGGAACCATACCTTTCCTTTACCCTTTTTGCACCGCAGGAATATCTTTCACGGGCTTATAATGATGCACCAAAG
TATTGCGCAATCATTGAATCAACCAGACTTGAAAAAGATGAAGTTATTTTTAAGGGTGAAATCCCTGCCCGTTGTATCGG
TGAATATAGGAATGATCTGAATTTTTATACAAATGGAAGAAGTGTCTGCATTACAGAATTAAAAGGGTATCAGGAAACTT
CCGGCGAGCCTGTATTTCAGCCACGCCGCCCGAACAGCCGTTTAGACAAGATCCGGCATATGTTTCAGAAGATAATGTAA