MEGAResFrom MEG, the Microbial Ecology Group

OTRA

The otrA gene encodes a tetracycline ribosomal protection protein.

References

Other Groups in Tetracycline resistance ribosomal protection proteins

Sequences

Download Sequences

>37|X53401.1|X53401|Tetracyclines|Tetracycline_resistance_ribosomal_protection_proteins|OTRA
ATGAACAAGCTGAATCTGGGCATCCTGGCCCACGTTGACGCCGGCAAGACCAGCCTCACCGAGCGCCTGCTGCACCGCAC
CGGTGTGATCGACGAGGTCGGCAGCGTGGACGCCGGCACCACGACGACCGACTCGATGGAGCTGGAGCGGCAGCGCGGCA
TCACCATCCGGTCCGCCGTGGCCACGTTCGTCCTGGACGATCTCAAGGTCAACCTCATCGACACCCCGGGCCACTCCGAC
TTCATCTCCGAGGTCGAGCGGGCGCTCGGGGTGCTCGACGGCGCGGTCCTGGTGGTCTCGGCCGTCGAGGGCGTCCAGCC
GCAGACCCGCATCCTGATGCGGACCCTGCGCAGGCTGGGCATTCCCACGCTGGTCTTCGTCAACAAGATCGACCGGGGCG
GCGCGCGTCCCGACGGTGTGCTGCGGGAGATCCGCGACCGGCTCACCCCCGCCGCGGTGGCACTGTCCGCCGTGGCGGAC
GCCGGCACGCCGCGGGCCCGCGCGATCGCGCTCGGCCCGGACACCGACCCGGACTTCGCCGTCCGGGTCGGTGAGCTGCT
GGCCGACCACGACGACGCGTTCCTCACCGCCTACCTGGACGAGGAACACGTACTGACCGAGAAGGAGTACGCGGAGGAAC
TGGCCGCGCAGACCGCGCGCGGTCTGGTGCACCCGGTGTACTTCGGGTCCGCGCTGACCGGCGAGGGCCTGGACCATCTG
GTGCACGGCATCCGGGAGTTGCTGCCGTCCGTGCACGCGTCGCAGGACGCGCCGCTGCGGGCCACCGTGTTCAAGGTGGA
CCGTGGCGCGCGCGGCGAGGCCGTCGCGTACCTGCGGCTGGTCTCCGGCACGCTGGGCACCCGCGATTCGGTGACGCTGC
ACCGCGTCGACCACACCGGCCGGGTCACCGAGCACGCCGGACGCATCACCGCGCTGCGGGTCTTCGAGCACGGGTCGGCC
ACCAGCGAGACCCGGGCGACCGCCGGGGACATCGCGCAGGCGTGGGGCCTGAAGGACGTACGGGTCGGTGACCGGGCCGG
GCACCTCGACGGTCCCCCGCCGCGCAACTTCTTCGCGCCGCCCAGCCTGGAGACCGTGATCAGGCCGGAGCGCCCGGAGG
AAGCGGGACGGCTGCACGCCGCGCTGCGCATGCTGGACGAGCAGGACCCCTCGATCGACCTGCGGCAGGACGAGGAGAAC
GCGGCCGGCGCGGTGGTCCGCCTCTACGGGGAGGTGCAGAAGGAGATCCTCGGCAGCACGCTCGCGGAGTCCTTCGGCGT
ACGGGTGCGCTTCGACCCGACCCGTACGGTCTGCATCGAAAAGCCCGTGGGGACCGGCGAGGCGCTGATCGAGCTGGACA
CGCGGACGCACAACTACTTCTGGGGCGCACCGTGGGTCTGCGCGTCGGACCGGCCGAGCCCGGCGCGGGCGATCACGTTC
CGTTTGGCGGTGGAACTGGGCTCGCTCCCCCTGGCCTTCCACAAGGCCATCGAGGAGACGGTGCACACCACCCTGCGGCA
CGGTCTGTACGGCTGGCAGGTCACCGACTGCGCCGTCACCCTGACCCGTACCGGCGTTCGCAGTCCGGTCAGCGCGGCCG
ACGACTTCCGCAAGGCCAACGCGCGCTTGGTCCTGATGGACGCGCTCGGCAGGGCCGGTACGGAGGTGCACGAGCCGGTC
AGCTCCTTCGAACTGGAGGTGCCCGCCGCCCGGCTCAGCCCGGTACTTGCGAAACTCGCGGAACTGGGCGCGACGCCCGG
TGTGCCCACGGCCGAGGGGGACGTCTTCCGCCTGGAGGGCACGATGCCGACCAGCCTCGTGCACGACTTCAACCAGCGGG
TTCCCGGACTGACCCAGGGCGAGGGCGTGTTCCTGGCCGAGCACCGGGGCTACCGGCCCGCCGTCGGACAGCCGCCCGTG
CGGCCGCGGCCCGAGGGGCCCAACCCGCTCAACCGCGACGAGTACATCCTGCACGTGCTCAAGCGCGTGTGA