MEGAResFrom MEG, the Microbial Ecology Group

TETZ

The tetZ gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>CARD|phgb|AF121000|0-1155|ARO:3000183|tetZ|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETZ
TTATCGAGATCGCCGTGAGGCGCATGTCTCACGGATCATCAGGAGGGCGCAGAGAACGTAGAGCGCTGCGGCGCAGATCC
AGAGGGTGCCGTCTGCATTCGTTCGGGTGAGTGCGAAAATGCCGGTGAAGGTGACCGGGCCGATGATCGAGGTGAGGCTG
TTCAGGCTTGCAAGTGTTCCCTGCAGGCGTCCCTGCTGCTGCTCGGGCGCGCGTCTCGAGAGCAGCGTCTGCAGTGCGGG
CAACGTGATGCTGCCGAGTCCGAGCGCTGCGAGGATCGGTAGCATCGCCCATGTGCTGGCGATGAGGGCAAGGCCGATGA
GCCCAATGGCGTCTGCGGCGATACCGACGAGGATCGCCCGGGTCTCGCCGATCCGGGACACGATGCGTCCGGTCAGTGCC
GCCTGCACGAATACTTGCACCATTCCGAAGATGGATAGCGAAACGCCGACTTCGACGGGGTTCCAGTCGAGGCGCTGCTG
CGTGAAGAGCACCCAGGTGGAGCCTGGTGCTTGGCCGATGAACTGCACGATGCCGAAGACTGCGAGAAGGATAAGCATCC
CCGGCACTGCGGTTCGCTTCGCCGTACCGGGTTGCTGTGCGTGCGAGCCGTTGCTGCCCGGTGGCCGCGTCTCACGCAGA
AGACTCGCGCTGAGTACGAGGGTGATTCCGGCGAGCGCGGCGGCGACGAGGAATGGCAGATGCGGTGAGACCCCGCCGAA
AAGACCGCCAATGGCGGGACCCGCGATCATGCCACCGCCGTAGCATGCGCCGAGCCACCCGTAGCGTTTTGCGCGCTGAT
CCGGCGGAGTAATGTCGGCGATCACCGTCGCGGTGACGGCGTTCGTGGCGCCGGTAATGCCTGCAACCGCGCGGGCGAGG
TAAAAGACCCACAGCGTGTCCGTCAGTGCGAGCACGAGGTAGTCGATCGTCGCGCCTGCGAGGGAGGCGACAAGCACGCG
GCGGCGTCCGAAACGGTCAGAGAGTCGGCCAAGGATCGGGGCGCAAAGAAACTGCATGATCGCATAGAGCGCTGTCAGTA
GTCCGACGTGCAGTGGGATCATGTCGTCGGGGGCACCGACCTGGTCGAGAAGGGTAGGCAAGATCGGCATCACGAGGCCC
AGCCCTGCAGCATCGAGGGTCGCCGTGATGAGCAC