MEGAResFrom MEG, the Microbial Ecology Group

TETY

The tetY gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|tetY|AF070999|1680-2855|1176|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETY
ATGTCAAAATCACTTATAACCGCACTCATTGTTGTCGCGCTTGATGCGATTGGTTTGGGATTAATCATGCCGGTGGTTCC
GGCTTTATTAAATGAATTTGTACCGGCAGAGCAAACAGCATTTCACTATGGTGTTTTTTTATCGCTTTATGCGTTTATGC
AGGTCTTTTGCGCGCCCGTTTTAGGGCGGTTATCTGACCGCTATGGACGGCGGATTATTTTGCTGGTTTCATTTTTAGGT
GCCACGATTGATTATAGCATAATGGCGGCAGCGCCTGTTTTATGGGTGCTTTATATCGGCCGGATTATCTCAGGTGTTAC
CGGAGCAACTGGTGCAATCGCGGCATCAATTATCGCTGATACAACTAAACAGGAAGAACGTGCGCGTTGGTTTGGTTTTA
TGGGGGCGTGTTTTGGTGCAGGTATGATTGCAGGGCCTGCTATTGGCGGTGTTCTTGGTGATATATCTGTGCATGCGCCC
TTTGTGGCAGGGGCTCTTCTCAATGCAATTGCCTTTTGTTTGGTGGCTTTCTTGTTGCCCAAAACGCCGTCACAACCGCC
TGAAGGACAGCCAGCCAAAATCAATTTGTTTGAAGGCTTTCGCTTCAATTTTGCAGTTCAGGGACTTGCCAGCTTTTTTG
CGTTGTTTTTTCTTATGCAGCTGATTGGGCAGGCGCCCGCCGCTTTGTGGGTGATTTATGGCGAACAGCGCTTGAATTGG
GATATTGGCACAGCAGGTGTGTCGCTGGCCGTTTTTGGTGCAGCACATACATTCGTACAAGCTGTTTTAACCGGCACTCT
TTCAAAGCGACTGGGTGACCGCGGTGTGTTGCTGCTTGGAATGGGCGCTGATATGTGCGGGTTTTTATTGCTGGCTTTTA
TCACGCAAAGCTGGATGGTTCTGCCGGCAATTTTTATGCTGGCCACAGGCGGCATTGGTATGCCTGCTTTGCAGGCCATT
ATTTCAGGTCTTGTTTGCGATGAAAAACAAGGTGCTTTACAGGGAACTTTAACGGGGTTGACGAATATAACCTCGATTAT
CGGGCCGGTCGGATTTACGACGCTTTATGGCTTAACCGCGGGGCAGTGGGATGGTTGGGTTTGGCTCGTCGCAGCAAGCC
TTTATCTTATTGCTATACCATTATTGCGCCAGTCAGCCAGTTTATTGCGATCTTAA

>Tet|tetY_5_AB089606|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETY
ATGTCAAAATCACTTATAACCGCACTCATTGTTGTCGCGCTTGATGCGATTGGTTTGGGATTAATCATGCCGGTGGTTCC
GGCTTTATTAAATGAATTTGTACCGGCAGAGCAAACAGCATTTCACTATGGTGTTTTTTTATCGCTTTATGCGTTTATGC
AGGTCTTTTGCGCGCCCGTTTTAGGGCGGTTATCTGACCGCTATGGACGGCGGATTATTTTGCTGGTTTCATTTTTAGGT
GCCACGATTGATTATAGCATAATGGCGGCAGCGCCTGTTTTATGGGTGCTTTATATCGGCCGGATCATCTCAGGTGTTAC
CGGAGCAACTGGTGCAATCGCGGCATCAATTATCGCTGATACAACTAAACAGGAAGAACGTGCGCGTTGGTTTGGTTTTA
TGGGGGCGTGTTTTGGTGCAGGTATGATTGCAGGGCCTGCTATTGGCGGTGTTCTTGGTGATATATCTGTGCATGCGCCC
TTTGTGGCAGGGGCTCTTCTCAATGCAATTGCTTTTTGTTTGGTGGCTTTCTTGTTGCCCAAAGCGTCGTCACAACCGCC
CGAAGGGCAGCCAGCCAAAATCAATTTGTTTGAAGGTTTTCGTTTCAATTTTGCAGTTCAGGGACTTACCAGCTTTTTTG
CGTTGTTTTTTCTTATGCAGCTGATCGGGCAGGCGCCCGCCGCTCTGTGGGTGATTTATGGCGAACAGCGCTTGAATTGG
GATATTGGCACAGCAGGTGTGTCGCTGGCCATTTTTGGTGCAGCACATACATTCGTACAAGCTGTTTTAACCGGCACTCT
TTCAAAGCGACTGGGCGACCGCGGTGTGTTGCTGCTTGGTATGGGCGCTGATATTTGCGGGTTTCTATTGCTGGCTTTTA
TCACGCAAAGCTGGATGGTTCTGCCGGCAATTTTCATGCTGGCTACAGGCGGCATTGGTATGCCTGCTTTGCAGGCTATT
ATTTCCGGTCTTGTTCGTGATGAAAAGCAAGGTGCTTTACAAGGAACTTTAACAGGCTTGACGAATATAACTTCGATCAT
CGGGCCGGTCGGATTTACGACGCTTTATGGCTTAACCGCGGGGCGGTGGGATGGTTGGGTTTGGCTCGTCGCAGCAAGTC
TTTATTTTATAGCTATACCATTATTGCGCCAGTCAGCCAGTTTGTTACGATCTTAA