MEGAResFrom MEG, the Microbial Ecology Group

TETV

The tetV gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>CARD|phgb|AF030344|0-1260|ARO:3000181|tetV|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETV
TCACAGCAGTGGGTTCGCCACCTCGTCACGGTGCATGCGCGCCGCGGTGAACGCCACGGCCGCGATCGCCACGGGCACCA
GACCCGCCGTCGCGAAGATCACCTCCATCGAGACCACCTTCGACAGCGGACCCACGATCGCGAATGACAACGGCATGAAC
GCCAGCGATACGAAGAAGTCCAGGCTCGACACGCGGCCCAGCATCTCGGTGGGCACACGCCGTTGCAGCAGCGTTCCCCA
GATCACCATGCCAGCGCCGTCGGTGACGCCGATGACGAACGTCGCAGCGGCCATCAGCGGGAACGACGATGTATATCCCA
CGATCACAAGGGGAATCGAGCCGAGACCCCACATCAGCATCATGGTCGTGAGATAGCGGCGCGGCATGCGCCGCGACGAC
ACCGTCAGCGCGCCCATCGCACTGCCGATACCGAAGAACGCCAGGATGAAACCGTAGGCGCGGGCGCCGTCGGCGAAGCG
GTCCTGTGCGATGAACGGCAGCAGCACCTCGATGGGTCCCAGCACGACGAGCACGAACATGCTCGCGAACAGCACGGTCC
ACAGCAGCCACGGTGTCTTCAGGACGAAGGCGAAACCTTCACGCAGGTCCCGCAATACGTGCGGGCGCTCATGGTGCTCG
GAGGCGGGCTGGGCGGGCGGACGGGTCGCGACCAGCAGCGCCAGGCCGAGCGCGAACAGCACCGCCACCACGACCGCGCC
GATCGACGGCATCGTTGCACCGATGACCATGCCGGCCACCGCGGGGCCCACCGAACGCTGGAACACCGGGCGTACCACGC
CCTCGACACCGTTGGCGGCCAGCAGCTGTTCGGGCGGCAGGATGCGCGGCAGGATCGCGCTGTAGGCCGGGAAGAAGAAC
GCCGCCGCGATGCCGAGAATGCCTGCGGCAACGGCCATGTGCCAGATCTTCAGCACGCCCAGCAGGGCCAGCGCGGAGAT
CACCGCGACCGTGACGAAGTTGACCACCTCGACGGCAATGATGATGGTGCGCTGGTTGATCCGGTCCGCGGTGATGCCGC
CGACGAGGACGAACGCGACCAGGCCGACACCGAGGCACGTCGCGACCAGCGACAGTGACGCCGGATCGTTGTCGATCGCG
ATCACCTGCAGCGCCATGACCACAGACCACATGCCCTCGGCGAAGATCGACAGCGTGACCGCGGCGATCAGCAGGCGGTA
CTCGCGGATCCGGAACGGTGCGAGTACGCGCCAGCCTGCGACCGGACGCGGCGAGCGCAC

>207|unknown_id|unknown_name|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETV
GTGCGCTCGCCGCGTCCGGTCGCAGGCTGGCGCGTACTCGCACCGTTCCGGATCCGCGAGTACCGCCTGCTGATCGCCGC
GGTCACGCTGTCGATCTTCGCCGAGGGCATGTGGTCTGTGGTCATGGCGCTGCAGGTGATCGCGATCGACAACGATCCGG
CGTCACTGTCGCTGGTCGCGACGTGCCTCGGTGTCGGCCTGGTCGCGTTCGTCCTCGTCGGCGGCATCACCGCGGACCGG
ATCAACCAGCGCACCATCATCATTGCCGTCGAGGTGGTCAACTTCGTCACGGTCGCGGTGATCTCCGCGCTGGCCCTGCT
GGGCGTGCTGAAGATCTGGCACATGGCCGTTGCCGCAGGCATTCTCGGCATCGCGGCGGCGTTCTTCTTCCCGGCCTACA
GCGCGATCCTGCCGCGCATCCTGCCGCCCGAACAGCTGCTGGCCGCCAACGGTGTCGAGGGCGTGGTACGCCCGGTGTTC
CAGCGTTCGGTGGGCCCCGCGGTGGCCGGCATGGTCATCGGTGCAACGATGCCGTCGATCGGCGCGGTCGTGGTGGCGGT
GCTGTTCGCGCTCGGCCTGGCGCTGCTGGTCGCGACCCGTCCGCCCGCCCAGCCCGCCTCCGAGCACCATGAGCGCCCGC
ACGTATTGCGGGACCTGCGTGAAGGTTTCGCCTTCGTCCTGAAGACACCGTGGCTGCTGTGGACCGTGCTGTTCGCGAGC
ATGTTCGTGCTCGTCGTGCTGGGACCCATCGAGGTGCTGCTGCCGTTCATCGCACAGGACCGCTTCGCCGACGGCGCCCG
CGCCTACGGTTTCATCCTGGCGTTCTTCGGTATCGGCAGTGCGATGGGCGCGCTGACGGTGTCGTCGCGGCGCATGCCGC
GCCGCTATCTCACGACCATGATGCTGATGTGGGGTCTCGGCTCGATTCCCCTTGTGATCGTGGGATATACATCGTCGTTC
CCGCTGATGGCCGCTGCGACGTTCGTCATCGGCGTCACCGACGGCGCTGGCATGGTGATCTGGGGAACGCTGCTGCAACG
GCGTGTGCCCACCGAGATGCTGGGCCGCGTGTCGAGCCTGGACTTCTTCGTATCGCTGGCGTTCATGCCGTTGTCATTCG
CGATCGTGGGTCCGCTGTCGAAGGTGGTCTCGATGGAGGTGATCTTCGCGACGGCGGGTCTGGTGCCCGTGGCGATCGCG
GCCGTGGCGTTCACCGCGGCGCGCATGCACCGTGACGAGGTGGCGAACCCACTGCTGTGA