MEGAResFrom MEG, the Microbial Ecology Group

TETK

The tetK gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>1454|J01764.1|PT1CG|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETK
TTGTTTAGTTTATATAAAAAATTTAAAGGTTTGTTTTATAGCGTTTTATTTTGGCTTTGTATTCTTTCATTTTTTAGTGT
ATTAAATGAAATGGTTTTAAATGTTTCTTTACCTGATATTGCAAATCATTTTAATACTACTCCTGGAATTACAAACTGGG
TAAACACTGCATATATGTTAACTTTTTCGATAGGAACAGCAGTATATGGAAAATTATCTGATTATATAAATATAAAAAAA
TTGTTAATTATTGGTATTAGTTTGAGCTGTCTTGGTTCATTGATTGCTTTTATTGGTCACAATCACTTTTTTATTTTGAT
TTTTGGTAGGTTAGTACAAGGAGTAGGATCTGCTGCATTCCCTTCACTGATTATGGTGGTTGTAGCTAGAAATATTACAA
GAAAAAAACAAGGCAAAGCCTTTGGTTTTATAGGATCAATTGTAGCTTTAGGTGAAGGGTTAGGTCCTTCAATAGGGGGA
ATAATAGCACATTATATTCATTGGTCTTACCTACTTATACTTCCTATGATTACAATAGTAACTATACCTTTTCTTATTAA
AGTAATGGTACCTGGTAAATCAACAAAAAATACATTAGATATCGTAGGTATTGTTTTAATGTCTATAAGTATTATATGTT
TTATGTTATTTACGACAAATTATAATTGGACTTTTTTAATACTCTTCACAATCTTTTTTGTGATTTTTATTAAACATATT
TCAAGAGTTTCTAACCCTTTTATTAATCCTAAACTAGGGAAAAACATTCCGTTTATGCTTGGTTTGTTTTCTGGTTGGGC
TAATATTTTCTATAGTAGCTGGTTTTATATCAATGGTGCCTTATATGATGAAAACTATTTATCATGTAAATGTAGCGACA
ATAGGTAA

>179|M16217.1|PNS1CG|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETK
TTGTTTAGTTTATATAAAAAATTTAAAGGTTTGTTTTATAGCGTTTTATTTTGGCTTTGTATTCTTTCATTTTTTAGTGT
ATTAAATGAAATGGTTTTAAATGTTTCTTTACCTGATATTGCAAATCATTTTAATACTACTCCTGGAATTACAAACTGGG
TAAACACTGCATATATGTTAACTTTTTCGATAGGAACAGCAGTATATGGAAAATTATCTGATTATATAAATATAAAAAAA
TTGTTAATTATTGGTATTAGTTTGAGCTGTCTTGGTTCATTGATTGCTTTTATTGGTCACAATCACTTTTTTATTTTGAT
TTTTGGTAGGTTAGTACAAGGAGTAGGATCTGCTGCATTCCCTTCACTGATTATGGTGGTTGTAGCTAGAAATATTACAA
GAAAAAAACAAGGCAAAGCCTTTGGTTTTATAGGATCAATTGTAGCTTTAGGTGAAGGGTTAGGTCCTTCAATAGGGGGA
ATAATAGCACATTATATTCATTGGTCTTACCTACTTATACTTCCTATGATTACAATAGTAACTATACCTTTTCTTATTAA
AGTAATGGTACCTGGTAAATCAACAAAAAATACATTAGATATCGTAGGTATTGTTTTAATGTCTATAAGTATTATATGTT
TTATGTTATTTACGACAAATTATAATTGGACTTTTTTAATACTCTTCACAATCTTTTTTGTGATTTTTATTAAACATATT
TCAAGAGTTTCTAACCCTTTTATTAATCCTAAACTAGGGAAAAACATTCCGTTTATGCTTGGTTTGTTTTCTGGTGGGCT
AATATTTTCTATAGTAGCTGGTTTTATATCAATGGTGCCTTATATGATGAAAACTATTTATCATGTAAATGTAGCGACAA
TAGGTAATAGTGTTATTTTTCCTGGAACCATGAGTGTTATTGTTTTTGGTTATTTTGGTGGTTTTTTAGTGGATAGAAAA
GGATCATTATTTGTTTTTATTTTAGGATCATTGTCTATCTCTATAAGTTTTTTAACTATTGCATTTTTTGTTGAGTTTAG
TATGTGGTTGACTACTTTTATGTTTATATTTGTTATGGGCGGATTATCTTTTACTAAAACAGTTATATCAAAAATAGTAT
CAAGTAGTCTTTCTGAAGAAGAAGTTGCTTCTGGAATGAGTTTGCTAAATTTCACAAGTTTTTTATCAGAGGGAACAGGT
ATAGCAATTGTAGGAGGTTTATTGTCACTACAATTGATTAATCGTAAACTAGTTCTGGAATTTATAAATTATTCTTCTGG
AGTGTATAGTAATATTCTTGTAGCCATGGCTATCCTTATTATTTTATGTTGTCTTTTGACGATTATTGTATTTAAACGTT
CTGAAAAGCAGTTTGAATAG