MEGAResFrom MEG, the Microbial Ecology Group

TETJ

The tetJ gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|tetJ_1_ACLE01000065|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETJ
ATGAATAAATCAATTATTATCATACTGCTTGTCACAGTATTAGATGCCATTGGTATTGGCCTTATCATGCCAGTACTACC
AACACTATTAAACGAGTTTGTGAGCGAAAACAGACTCGCCAATCATTACGGTATATTATTAGCACTCTATGCGACGATGC
AGGTGATCTTCGCACCTATTTTAGGAAAATTATCAGATAAATATGGCAGAAAACCTATTTTATTATTTTCGCTATTGGGT
GCGGCATTAGATTACCTATTAATGGCTTGCTCTACCTCATTATGGATGCTCTACATTGGACGCATTATTGCGGGTATAAC
AGGAGCCACTGGTGCAGTATGCGCATCAGCAATGACTGATGTTACTCACCCTCATGAAAGAACACGCTATTTCGGTTTTT
TGGGTGGTGCATTTGGTGTGGGTTTAATTATTGGCCCCATGTTAGGGGGATTACTGGGTGAGATCAGCGCCCATACGCCA
TTTATCTTTGCGGCTATTTCTCATTCGTTATTATTTATATTTTCATTACTTTGTTTCCAAGAAACTCAAACCACAAAAAT
ATCGACTGAAATATCCGCATTAAATCAGGATACAGCACCTCACTCTGCCACTGGTTTTATTAAAAAGAGTCTCTGTTTTT
GGCTTATTGCCTATTTTATTATTCAACTAATAGGGCAAATTCCGGCCACTATTTGGGTGCTATTCACACAAGTGCGTTTC
GCTTGGCACACTACTGAAGTAGGTTTATCTCTTGCATTTCTTGGTGTATTACATATTTTTTTTCAAGCGGTTCTCGCAGG
AAAACTGGCGCAAAAATGGGGAGAACGCAACACGGTTATCATTAGCATGTCTATTGATGCATTTGGTTGCTTATTATTAG
CCTGGATAAGCCATGTTTGGGTTATGCTCCCCGCTTTAATCTGTTTAGCTGCGGGAGGAATGGGACAACCTGCTTTACAA
GGATATTTATCAAAATCTGTTGATCATCATGTTCAAGGACAATTACAAGGAACGTTAGTAAGTCTAACGAATATAACTGG
GATTGTCGGCCCGTTACTCTTCTCTTTTATTTATAGTTACAGCGTTGAATATTGGGATGGCTTATTGTGGTTTATTGGTG
CAATGCTTTACAGTGGATTACTTGTAGCCAGTTATTTTAAACAGAAATCACCAATATTAAAAAAATTTCCCTCATAA

>Tet|TetJ|AF038993|1084-2280|1197|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETJ
ATGAATAAATCAATTATTATCATACTGCTTGTCACAGTATTAGATGCCATTGGTATTGGCCTTATCATGCCAGTACTACC
AACACTATTAAACGAGTTTGTGAGCGAAAACAGACTCGCCAATCATTACGGTATATTATTAGCACTCTATGCGACGATGC
AGGTGATCTTCGCACCTATTTTAGGAAAATTATCAGATAAATATGGCAGAAAACCTATTTTATTAATTTCGCTATTGGGT
GCCGCATTAGATTACCTATTAATGGCTTGCCCCACCTCATTATGGATGCTCTACATTGGACGAATAATTGCGGGTATAAC
AGGAGCCACTGGTGCAGTATGCGCATCAGCAATGACTGATGTAACTCATCCTCATGAAAGAACACGCTATTTCGGTTTTT
TGGGTGGTGCATTTGGTGTGGGTTTAATTATTGGCCCCATGTTAGGGGGATTACTCGGTGAGATCAGCGCCCATACGCCA
TTTATCTTTGCGGCTATTTCTCATTCGTTATTATTTATATTTTCATTACTTTGTTTCCAAGAAACTCAAACCACAAAAAT
TTCGACTGAAATATCCGCATTAAATCAGGATACAGCGCCTCACTCTACCACTGGTTTTATTAAAAAGAGTCTCTTTTTTT
GGCTTATTGCCTATTTTATTATTCAACTAATAGGGCAAATTCCGGCCACTATTTGGGTGCTATTCACACAAGTTCGTTTC
GCTTGGCACACTACTGAAGTAGGTTTATCTCTTGCATTTCTTGGTGTATTACATATTTTTTTTCAAGCGGTTCTCGCAGG
AAAACTGGCGCAAAAATGGGGAGAACGCAACACGGTTATCATTAGCATGTCAATTGATGCATTTGGTTGCTTATTATTAG
CCTGGATAAGCCATGTTTGGGTTATGCTTCCCGCTTTAATCTGTTTAGCTGCGGGAGGAATGGGACAACCTGCTTTACAA
GGATATTTATCAAAATCTGTTGATCATCATGTTCAAGGACAGTTACAAGGAACGTTAGTCAGTCTAACGAATATAACTGG
GATTGTCGGCCCGTTACTCTTCTCTTTTATTTATAGTTACAGCGTTGAATATTGGGATGGCTTATTGTGGTTTATTGGTG
CAATGCTTTACAGTGGGTTACTTGTAGCCAGTTATTTTAAACAGAAATCACCAATATTAAAAAAATTTCCCTCATAA