MEGAResFrom MEG, the Microbial Ecology Group

TETG

The tetG gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|tetG_2_AF133139|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETG
GTGCGCAGCTCTGCCATCATTGCCCTGCTGATCGTCGGTCTCGACGCCATAGGACTCGGCCTCATAATGCCGGTCCTTCC
GACGCTTCTGCGCGAGCTTGTGCCGGCAGAGCAGGTCGCTGGTCACTATGGTGCTTTGCTGTCGCTCTATGCGTTGATGC
AGGTCGTCTGCGCCCCTCTACTTGGGCAATTTTCAGATGGTTACGGTCGGCGTCCGGTGCTTCTGGCTTCTCTTGCGGGG
GCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTGCTGTATATTGGCCGGCTCATTTCTGGCATCAC
GGGAGCAACCGGAGCTGTAGCTGCCTCAACCATTGCCGATTCGACAGGGGAAGGGTCTCGCGCACGCTGGTTCGGCTACA
TGGGAGCCTGTTATGGGACAGGCATGATTGCCGGGCCAGCACTTGGTGGCATGCTCGGTGGTATTTCTGCTCATGCTCCG
TTTATCGCCGCTGCCCTTCTAAACGGCTTCGCGTTCCTGCTTGCCTGCATTTTTCTCAAGGAGACTAATCGCAGCCATGG
CGAGACCGGAAAACTGGTCCGCATCGAACCATTCGTTCTGTTCCGGCTGGATGATGCATTGCGTGGACTAACCGCGCTTT
TCGCAGTTTTCTTCACTATTCAACTGATCGGCCAAGTGCCTGCGGCCCTATGGGTCATATATGGCGAGGACCGTTTTCAG
TGGGACACCACGACCGTTGGTTTGTCGCTCGCGGCGTTTGGAGCAACACATGCGATCTTCCAAGCGTTTGTTACCGGCCC
TCTTTCAAGCCGGCTTGGAGAGCGGCGCACATTACTGTTTGGCATGGCTGCGGATGCGACTGGCTTCATTCTTCTAGCTT
TTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGCTGCTGCTTGCCGCCGGGGGCGTTGGCATGCCGGCCTTGCAGGCA
ATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGAGCTCTACAGGGAACGCTTACAAGCCTCACCAATCTAAGCTCTAT
CGCGGGACCGCTTGGCTTCACGGCACTCTATTCTGCCACCATAGGAGCATGGACCGGTTGGGTTTGGATTGTCGGCGCGA
TCCTCTATTTAATATGTCTGCCAATACTACGCAGACCTTTCGCAACTTCATTGTGA

>Tet|tetG_1_AJ276217|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETG
GCTGCTGATCGTGGGTCTCGACGCCATGGGACTCGGCCTCATCATGCCGGTCCTTCCGGCGCTTCTGCGCGAGCTTGTGC
CGGCGGAGCAGGTCGCTGGTCACTATGGTGCTTTGCTGTCACTCTATGCGTTGATGCAGGTCATCTTCGCGCCCGTGCTT
GGACAGTTTTCAGATGCTTACGGTCGGCGTCCGGTGCTTCTGGCTTCTCTTGCGGGGGCCGCAGTCGATTACACGATTAT
GGCATCAGCGCCGGTCTTATGGGTTCTCTATATCGGCCGAATCGTTTCCGGCGTCACGGGAGCAACCGGAGCCGTAGCAG
CCTCAACCATTGCCGATTCGACGGGGGAAGGTTCTCGCGCACGCTGGTTCGGCTACATGGGGGCCTGTTATGGAGCAGGC
ATGATTGCCGGGCCAGCACTTTGTGGCATGCTCGGTGGTATTTCTGCCCATGCTCCGTTTATCGCTGCTGCCCTTCTCAA
CGGCTTCGCGTTCCTGCTTGCCTACATTTTTCTCAAGGAGACTCATCACAGCCATGGCGGGACCCGAAAGCCGGTTCGCA
TCAAACCATTCGTTCTGTTCCGGCTGGATGATACATTGCGCGGGCTAGGTGCGCTTTTCGCAGTTTTCTTCATTATTCAA
CTGATCGGCCAAGTGCCTGCAGCCCTATGGGTCATCTATGGCGAGGACCGTTTTCAGTGGGACACCACGACTGTTGGTTT
GTCGCTCGCGGCATTTGGAGCAACACACGCGATCTTCCAAGCGTTTGTTACCGGTCCGCTTTCAAGCCGGCTTGGAGAGC
GGCGCACGCTACTCTTTGGCATGGCTGCGGATGCGACTGGCTTCATTCTTCTGGCTTTTGCCACGCAGGGATGGATGGTG
TTCCCGATTTTGTTGCTGCTTGCCGCCGGAGGTGTTGGCATGCCGGCCTTGCAGGCAATGCTTTCAAATAATGTCAGCGG
TAACAAGCAAGGAGCTTTACAGGGAACGCTTACAAGCCTCACCAATTTAAGTTCTATCGCAGGACCGCTTGGCTTCACGG
CACTCTATTCTGCCACCGCCGGAGCATGGAACGGTTGGGTTTGGATTGTCGGCGCGATCCTCTATTTAATATGTCTGCCA
ATACTACGCAGACCATTCGCA

>Tet|tetG_3_S52437|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETG
GTGCGCAGCTCTGCCATCATTGCCCTGCTGATCGTGGGTCTTGACGCCATGGGTCTCGGCCTCATCATGCCCGTCCTTCC
GACGCTTCTGCGTGAGCTTGTGCCAGCAGAGCAGGTCGCTGGACACTATGGTGCCTTGCTGTCGCTCTATGCATTGATGC
AGGTCGTCTTCGCGCCCATGCTTGGACAGCTTTCGGATTCTTACGGTCGGCGTCCGGTACTTCTGGCTTCTCTTGCAGGA
GCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTGCTCTATATCGGCCGACTCGTGTCCGGCGTCAC
GGGCGCAACCGGAGCTGTAGCAGCCTCAACCATTGCCGATTCGACGGGGGAAGGTTCTCGCGCACGCTGGTTCGGCTACA
TGGGGGCCTGTTATGGGGCGGGCATGATTGCCGGGCCAGCACTTGGTGGCATGCTCGGTGGTATCTCTGCTCATGCCCCG
TTTATCGCCGCCGCCCTTCTCAACGGGTTCGCGTTCCTGCTTGCCTGCATTTTCCTCAAGGAGACTCATCACAGCCATGG
CGGGACCGGAAAGCCGGTTCGCATCAAACCATTCGTTCTGTTACGGCTGGATGATGCATTGCGCGGGCTAGGTGCGCTTT
TCGCAGTTTTCTTCATTATTCAACTGATCGGCCAAGTGCCTGCAGCCCTATGGGTCATATATGGCGAGGACCGTTTTCAG
TGGAACACCGCGACCGTTGGTTTGTCGCTCGCGGCGTTTGGGGCAACACATGCGATCTTCCAAGCGTTTGTTACCGGCCC
GCTTTCAAGCCGGCTTGGAGAGCGGCGCACGCTGCTGTTTGGCATGGCTGCGGATGGCACTGGCTTCGTTCTTCTGGCTT
TTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGTTGCTGCTTGCCGCCGGGGGTGTTGGCATGCCGGCCTTGCAGGCA
ATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGGGCTTTGCAAGGAACGCTAACGAGCCTCACCAATCTAAGCTCTAT
CGCAGGACCGCTTGGCTTCACAGCACTCTATTCTGCCACCGCCGGGGCATGGAACGGTTGGGTTTGGATTGTCGGCGCGA
TCCTCTATTTAATATGTCTGCCAATACTACGCAGACCATTCGCAACTTCATTGGTGATTTAG

>Tet|TetG|AF133140|757-1932|1176|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETG
GTGCGCAGCTCTGCCATCATTGCCCTGCTGATCGTGGGTCTTGACGCCATGGGTCTCGGCCTCATCATGCCCGTCCTTCC
GACGCTTCTGCGTGAGCTTGTGCCAGCAGAGCAGGTCGCTGGACACTATGGTGCCTTGCTGTCGCTCTATGCATTGATGC
AGGTCGTCTTCGCGCCCATGCTTGGACAGCTTTCGGATTCTTACGGTCGGCGTCCGGTACTTCTGGCTTCTCTTGCAGGA
GCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTGCTCTATATCGGCCGACTCGTGTCCGGCGTCAC
GGGCGCAACCGGAGCTGTAGCAGCCTCAACCATTGCCGATTCGACGGGGGAAGGTTCTCGCGCACGCTGGTTCGGCTACA
TGGGGGCCTGTTATGGGGCGGGCATGATTGCCGGGCCAGCACTTGGTGGCATGCTCGGTGGTATCTCTGCTCATGCCCCG
TTTATCGCCGCCGCCCTTCTCAACGGGTTCGCGTTCCTGCTTGCCTGCATTTTCCTCAAGGAGACTCATCACAGCCATGG
CGGGACCGGAAAGCCGGTTCGCATCAAACCATTCGTTCTGTTACGGCTGGATGATGCATTGCGCGGGCTAGGTGCGCTTT
TCGCAGTTTTCTTCATTATTCAACTGATCGGCCAAGTGCCTGCAGCCCTATGGGTCATATATGGCGAGGACCGTTTTCAG
TGGAACACCGCGACCGTTGGTTTGTCGCTCGCGGCGTTTGGGGCAACACATGCGATCTTCCAAGCGTTTGTTACCGGCCC
GCTTTCAAGCCGGCTTGGAGAGCGGCGCACGCTGCTGTTTGGCATGGCTGCGGATGCGACTGGCTTCGTTCTTCTGGCTT
TTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGTTGCTGCTTGCCGCCGGGGGTGTTGGCATGCCGGCCTTGCAGGCA
ATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGGGCTTTGCAAGGAACGCTAACGAGCCTCACCAATCTAAGCTCTAT
CGCAGGACCGCTTGGCTTCACAGCACTCTATTCTGCCACCGCCGGGGCATGGAACGGTTGGGTTTGGATTGTCGGCGCGA
TCCTCTATTTAATATGTCTGCCAATACTACGCAGACCATTCGCAACTTCATTGTGA

>Tet|tetG_5_AF071555|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETG
ATGGGTCTCGGCCTCATCATGCCCGTCCTTCCGACGCTTCTGCGTGAGCTTGTGCCAGCAGAGCAGGTCGCTGGACACTA
TGGTGCCTTGCTGTCGCTCTATGCATTGATGCAGGTCGTCTTCGCGCCCATGCTTGGACAGCTTTCGGATTCTTACGGTC
GGCGTCCGGTACTTCTGGCTTCTCTTGCAGGAGCCGCAGTCGATTACACGATTATGGCATCAGCGCCGGTCTTATGGGTG
CTCTATATCGGCCGACTCGTGTCCGGCGTCACGGGCGCAACCGGAGCTGTAGCAGCCTCAACCATTGCCGATTCGACGGG
GGAAGGTTCTCGCGCACGCTGGTTCGGCTACATGGGGGCCTGTTATGGGGCGGGCATGATTGCCGGGCCAGCACTTGGTG
GCATGCTCGGTGGTATCTCTGCTCATGCCCCGTTTATCGCCGCCGCCCTTCTCAACGGGTTCGCGTTCCTGCTTGCCTGC
ATTTTCCTCAAGGAGACTCATCACAGCCATGGCGGGACCGGAAAGCCGGTTCGCATCAAACCATTCGTTCTGTTACGGCT
GGATGATGCATTGCGCGGGCTAGGTGCGCTTTTCGCAGTTTTCTTCATTATTCAACTGATCGGCCAAGTGCCTGCAGCCC
TATGGGTCATATATGGCGAGGACCGTTTTCAGTGGAACACCGCGACCGTTGGTTTGTCGCTCGCGGCGTTTGGGGCAACA
CATGCGATCTTCCAAGCGTTTGTTACCGGCCCGCTTTCAAGCCGGCTTGGAGAGCGGCGCACGCTGCTGTTTGGCATGGC
TGCGGATGCGACTGGCTTCGTTCTTCTGGCTTTTGCCACGCAGGGATGGATGGTGTTCCCGATTCTGTTGCTGCTTGCCG
CCGGGGGTGTTGGCATGCCGGCCTTGCAGGCAATGCTCTCAAACAATGTCAGCAGTAACAAGCAAGGGGCTTTGCAAGGA
ACGCTAACGAGCCTCACCAATCTAAGCTCTATCGCAGGACCGCTTGGCTTCACAGCACTCTATTCTGCCACCGCCGGGGC
ATGGAACGGTTGGGTTTGGATTGTCGGCGCGATCCTCTATTTAATATGTCTGCCAATACTACGCAGACCATTCGCAACTT
CATTGTGA