MEGAResFrom MEG, the Microbial Ecology Group

TETD

The tetD gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|NC_010558.1.6276025|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETD
ATGTATATTGAACAGCATTCTCGCTATCAAAATAAAGCTAATAACATCCAATTAAGATATGATGATAAGCAGTTTCATAC
AACGGTTATCAAAGATGTTCTATTATGGATTGAACATAATTTAGATCAGTCTTTACTGCTTGATGATGTGGCGAATAAAG
CGGGTTATACCAAGTGGTATTTTCAGCGGCTGTTCAAAAAAGTAACAGGGGTCACACTGGCTAGCTATATTCGTGCTCGT
CGTTTGACGAAAGCGGCTGTTGAGTTGAGGTTGACGAAAAAAACTATCCTTGAGATCGCATTAAAATATCAATTTGATTC
CCAACAATCTTTTACACGTCGATTTAAGTACATTTTTAAGGTTACACCAAGTTATTATCGGCGTAATAAATTATGGGAAT
TGGAGGCAATGCACTGA

>CARD|phgb|BX664015|204137-204554|ARO:3000168|tetD|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETD
TCAGTGCATTGCCTCCAATTCCCATAATTTATTACGCCGATAATAACTTGGTGTAACCTTAAAAATGTACTTAAATCGAC
GTGTAAAAGATTGTTGGGAATCAAATTGATATTTTAATGCGATCTCAAGGATAGTTTTTTTCGTCAACCTCAACTCAACA
GCCGCTTTCGTCAAACGACGAGCACGAATATAGCTAGCCAGTGTGACCCCTGTTACTTTTTTGAACAGCCGCTGAAAATA
CCACTTGGTATAACCCGCTTTATTCGCCACATCATCAAGCAGTAAAGACTGATCTAAATTATGTTCAATCCATAATAGAA
CATCTTTGATAACCGTTGTATGAAACTGCTTATCATCATATCTTAATTGGATGTTATTAGCTTTATTTTGATAGCGAGAA
TGCTGTTCAATATACATA

>Tet|tetD_5_X65876|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETD
ATGAATAAACCCGCTGTCATCGCGCTGGTGATTACACTGCTGGACGCGATGGGAATTGGTCTGATCATGCCGGTATTACC
GTCACTGCTGCGGGAATATCTCCCGGAAGCGGATGTGGCAAACCATTACGGCATTCTGCTGGCGCTGTATGCGGTGATGC
AGGTCTGTTTTGCTCCGCTGCTGGGCAGATGGTCAGATAAGCTGGGGCGCAGACCGGTGCTGCTGTTATCCCTGGCGGGT
GCCGCGTTTGATTACACACTGCTGGCACTGTCCAATGTGCTGTGGATGTTGTATCTCGGGCGGATTATCTCCGGGATCAC
TGGTGCCACCGGCGCGGTTGCGGCTTCGGTAGTGGCGGACAGCACGGCGGTCAGCGAGCGTACCGCCTGGTTCGGCCGTC
TCGGTGCGGCCTTTGGTGCCGGGCTGATTGCCGGGCCGGCTATCGGCGGACTGGCGGGGGATATCTCACCGCATCTGCCG
TTTGTCATTGCGGCAATACTGAATGCCTGCACCTTTCTGATGGTCTTTTTTATCTTTAAACCGGCGGTACAGACAGAAGA
AAAACCGGCGGACGAGAAACAAGAAAGCGCAGGTATCAGCTTTATCACACTGCTTAAACCTCTGGCGCTGTTGCTGTTTG
TCTTTTTTACCGCGCAGCTTATCGGGCAGATCCCGGCCACTGTCTGGGTATTGTTTACGGAGAGCCGCTTTGCCTGGGAC
AGCGCGGCGGTCGGTTTTTCACTGGCGGGACTCGGGGCGATGCATGCACTGTTTCAGGCGGTGGTTGCCGGGGCGCTGGC
AAAACGGCTGAGTGAGAAAACCATTATTTTCGCCGGATTTATTGCCGATGCCACCGCGTTTTTACTGATGTCTGCTATCA
CTTCCGGATGGATGGTGTATCCGGTCCTGATCCTGCTGGCAGGCGGCGGAATTGCACTGCCTGCATTGCAGGGCATTATC
TCTGCCGGGGCATCGGCGGCAAATCAGGGAAAACTACAGGGTGTGCTGGTCAGCCTGACCAATCTGACCGGCGTGGCGGG
CCCGCTGCTGTTTGCTTTTATTTTCAGTCAGACACAGCAGAGTGCGGACGGTACGGTGTGGCTGATTGGCACGGCACTGT
ACGGTCTGCTGCTGGCAATCTGTCTGCTGATCAGAAAACCGGCACCGGTGGCGGCCACCTGCTGA

>Tet|TetD|AB089602|1521-2705|1185|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETD
ATGAATAAACCCGCTGTCATCGCGCTGGTGATTACACTGCTGGACGCGATGGGAATTGGTCTGATCATGCCGGTATTACC
GTCACTGCTGCGGGAATATCTCCCGGAAGCGGATGTGGCAAACCATTACGGCATTCTGCTGGCGCTGTATGCGGTGATGC
AGGTCTGTTTTGCTCCGCTGCTGGGCAGATGGTCAGATAAGCTGGGGCGCAGACCGGTGCTGCTGTTATCCCTGGCGGGT
GCCGCGTTTGATTACACACTGCTGGCACTGTCCAATGTGCTGTGGATGTTGTATCTCGGGCGGATTATCTCCGGGATCAC
TGGTGCCACCGGCGCGGTTGCGGCTTCGGTAGTGGCGGACAGCACGGCGGTCAGCGAGCGTACCGCCTGGTTCGGCCGTC
TCGGTGCGGCCTTTGGTGCCGGGCTGATTGCCGGGCCGGCTATCGGCGGACTGGCGGGGGATATCTCACCGCATCTGCCG
TTTGTCATTGCGGCAATACTGAATGCCTGCACCTTTCTGATGGTCTTTTTTATCTTTAAACCGGCGGTACAGACAGAAGA
AAAACCGGCGGAGCAGAAACAAGAAAGCGCAGGTATCAGCTTTATCACACTGCTTAAACCTCTGGCGCTGTTGCTGTTTG
TCTTTTTTACCGCGCAGCTTATCGGGCAGATCCCGGCCACTGTCTGGGTATTGTTTACGGAGAGCCGCTTTGCCTGGGAC
AGCGCGGCGGTCGGTTTTTCACTGGCGGGACTCGGGGCGATGCATGCACTGTTTCAGGCGGTGGTTGCCGGGGCGCTGGC
AAAACGGCTGAGTGAGAAAACCATTATTTTCGCCGGATTTATTGCCGATGCCACCGCGTTTTTACTGATGTCTGCTATCA
CTTCCGGATGGATGGTGTATCCGGTCCTGATCCTGCTGGCAGGCGGCGGAATTGCACTGCCTGCATTGCAGGGCATTATC
TCTGCCGGGGCATCGGCGGCAAATCAGGGAAAACTACAGGGTGTGCTGGTCAGCCTGACCAATCTGACCGGCGTGGCGGG
CCCGCTGCTGTTTGCTTTTATTTTCAGTCAGACACAGCAGAGTGCGGACGGTACGGTGTGGCTGATTGGCACGGCACTGT
ACGGTCTGCTGCTGGCAATCTGTCTGCTGATCAGAAAACCGGCACCGGTGGCGGCCACCTGCTGA