MEGAResFrom MEG, the Microbial Ecology Group

TETB

The tetB gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>Tet|AB089595.1|gene1|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETB
ATGAATAGTTCGACAAAGATCGCATTGGCAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAATTTATTGCTTCGGAAGATATCGCTAACCACTTTGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCACTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGGATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGTTTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATCAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTAACAATGCAACCGGTGT
TATTGGCCCATTACTGTTTGCTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG

>Tet|tetB_4_AF326777|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETB
ATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAATTTATTGCTTCGGAAGATATCGCTAACCACTTTGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCGCTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGGATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGTTTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATCAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTACCAATGCAACCGGTGT
TATTGGCCCATTACTGTTTGCTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG

>43|L20800.1|CLOTETP|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETB
ATGAAGAAAATAATTAATATAGGAATCGTAGCACACGTGGATGCAGGAAAAACAACTATAACAGAAAACTTATTATATTA
TAGTGGAGCTATAAAATCAGTTGGAAGAGTTGATTTAGGCAATACACAGACGGATTCTATGGAGCTTGAGCGTAAGAGAG
GAATTACCATTAAATCGTCAACCATATCTTTTAATTGGAATAATGTTAAGGTGAATATTATTGATACTCCAGGACATGTG
GATTTTATTTCGGAAGTTGAACGTTCATTAAATAGCTTAGATGGAGCAATACTAGTTATATCAGGAGTAGAGGGGATTCA
GTCACAAACAAGAATATTATTTGACACATTAAAGGAGTTAAATATTCCAACAATAATTTTTGTAAATAAGCTAGATAGAA
TTGGGGCAAATTTCAACAAAGTATTTGAAGAAATAAAGAAGAATATGTCCAATAAAGTAGTTAGATTACAAGAAGTATAT
GATGTAGGAAGCAAAGCTGTTTATATAAAAAAACTATTTGATACATGCATAATAAATGATGATGCTATTAATGTTTTATC
AGACTTAGACGAAGCATTTTTAGAAAGATATATTGGTGGAATAGAACCTGATAAAGAAGAAATACAAGAAAAGCTTTCAT
TATATGCAAGAGAAGGAAGTCTATATCCAGTATTTTGTGGTGCTGCAGCAATTGGACTTGGAATTGAAGATTTATTAGAT
GGAATTTGTAGTTATTTTCCATTTGCAAGTAATGATTGTGAAAGTGATTTATCTGGGGTAGTATTTAAAATCGAAAGAAC
AAGTAAAAATGAAAAGAAGGTTTATGTAAGATTATTTGGAGGAAAAATATCTGTAAGAGATAAAATTCAAGTACCTAATA
AGGAGATAGCAGAAAAAGTAAAGAAAATTAATAGGTTAGAAAATGGGGGAGTTGTTGAAGCACAGAGGATAGAAGCAGGG
GATATAGGTATTTTATATGGACTTACAAGTTTCCAAGTGGGAGATGTTATTGGAATTTCAAATGATAAAATTAAAAATAT
ATCTATAGCTAAACCAGCATTAAAAACAACAATTTCTGCAATTGATAAAGAAAAAAATCCAGAGCTATTTAAAGCATTAA
CATTACTTGCAGAGGAAGATCCACTACTCGCCTTCGCGATGAATGACATAGATAAAGAAATTTATGTCAACTTATTCGGT
GAAGTTCAAATGGAAATACTAAGTTCCATGTTAGATGATTTATATGGAATAAAAGTAGAGTTTTCGAATATTGAGACTAT
CTATAAGGAAACACCTAAAGGTTTTGGAGCGTCAATAATGCATATGCAGGAAGACTTAAATCCATTTTGGGCGACAGTAG
GCTTAGAAATAGAACCAGCAGGGAGAGGCGAAGGTCTTAGGTATATTTCTAATGTTTCAGTAGGGTCATTGCCAAAATCT
TTTCAAAATGCAATTGAAGAAGCAGTTATTAAGACAAGTAAACAAGGATTATTTGGATGGGAGGTTACAGATGTAAAAGT
CACTCTTAGCTGTGGTGAATTTTTTAGTCCAGCCAGCACTCCAGCAGATTTTAGAAATGTGACACCTATGGTATTCATGG
AAGCATTATATAAAGCACAAACTGTTTTATTAGAGCCATTACATGAGTTTGAGTTAAAGATTCCTCAAAATGCTTTAAGC
AAAGCGGTATGGGATTTAGAAACTATGAGGGCAACCTTTGATAATCCTATTGTTATAGGGGATGAATTCTCAATAAAGGG
ATTAATTCCAGTAGAAAATTCAAAAGAATATAAAATGAAAATAGCTTCATATACAGAAGGTAGAGGAATGTTTGTGACAA
AATTTTATGGGTATAAGGAAGCTTCAGCTGAATTTTCAAAAGCACGCAAAAAAACAACGTATGATCCATTGAATAAAAAA
GAGTATTTGCTTCATAAACTAAACGCAATTAGAGATTAA

>Tet|tetB_3_AP000342|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETB
ATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAATTTATTGCTTCGGAAGATATCGCTAACCACTTTGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCACTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGGATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGTTTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATCAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTACCAATGCAACCGGTGT
TATTGGCCCATTACTGTTTGCTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG

>Tet|TetB|AB089594|1-1206|1206|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETB
ATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAACTTATTGCTTCGGAAGATATCGCTAACCACTTAGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCACTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGGATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGTTTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATCAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTAACAATGCAACCGGTGT
TATTGGCCCATTACTGTTTGCTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG

>Tet|tetB_5_AJ277653|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETB
ATGAATAGTTCGACAAAGATCGCATTGGTAATTACGTTACTCGATGCCATGGGGATTGGCCTTATCATGCCAGTCTTGCC
AACGTTATTACGTGAATTTATTGCTTCGGAAGATATCGCTAACCACTTTGGCGTATTGCTTGCACTTTATGCGTTAATGC
AGGTTATCTTTGCTCCTTGGCTTGGAAAAATGTCTGACCGATTTGGTCGGCGCCCAGTGCTGTTGTTGTCATTAATAGGC
GCATCGCTGGATTACTTATTGCTGGCTTTTTCAAGTGCGCTTTGGATGCTGTATTTAGGCCGTTTGCTTTCAGGGATCAC
AGGAGCTACTGGGGCTGTCGCGGCATCGGTCATTGCCGATACCACCTCAGCTTCTCAACGCGTGAAGTGGTTCGGTTGGT
TAGGGGCAAGTTTTGGGCTTGGTTTAATAGCGGGGCCTATTATTGGTGGTTTTGCAGGAGAGATTTCACCGCATAGTCCC
TTTTTTATCGCTGCGTTGCTAAATATTGTCACTTTCCTTGTGGTTATGTTTTGGTTCCGTGAAACCAAAAATACACGTGA
TAATACAGATACCGAAGTAGGGGTTGAGACGCAATCGAATTCGGTATACATCACTTTATTTAAAACGATGCCCATTTTGT
TGATTATTTATTTTTCAGCGCAATTGATAGGCCAAATTCCCGCAACGGTGTGGGTGCTATTTACCGAAAATCGTTTTGGA
TGGAATAGCATGATGGTTGGCTTTTCATTAGCGGGTCTTGGTCTTTTACACTCAGTATTCCAAGCCTTTGTGGCAGGAAG
AATAGCCACTAAATGGGGCGAAAAAACGGCAGTACTGCTCGAATTTATTGCAGATAGTAGTGCATTTGCCTTTTTAGCGT
TTATATCTGAAGGTTGGTTAGATTTCCCTGTTTTAATTTTATTGGCTGGTGGTGGGATCGCTTTACCTGCATTACAGGGA
GTGATGTCTATCCAAACAAAGAGTCATGAGCAAGGTGCTTTACAGGGATTATTGGTGAGCCTTACCAATGCAACCGGTGT
TATTGGCCCATTACTGTTTACTGTTATTTATAATCATTCACTACCAATTTGGGATGGCTGGATTTGGATTATTGGTTTAG
CGTTTTACTGTATTATTATCCTGCTATCGATGACCTTCATGTTAACCCCTCAAGCTCAGGGGAGTAAACAGGAGACAAGT
GCTTAG