MEGAResFrom MEG, the Microbial Ecology Group

TETA

The tetA gene encodes a tetracycline efflux pump.

References

Other Groups in Tetracycline resistance major facilitator superfamily MFS efflux pumps

Sequences

Download Sequences

>1531|unknown_id|unknown_name|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
GTGAAACCCAACAGACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGT
GCTGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGT
TGATGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCGGTCTTGCTCGTCTCGCTG
GCCGGCGCTGCTGTCGACTACGCCATCATGGCGACGGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGG
CATCACCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCG
GCTTCATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCAC
GCTCCGTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACAAAGG
CGAACGCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCG
CCCTGATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGC
TTTCACTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCAC
CGGCCCTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGC
TTGCCTTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTG
CAAGCAATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGAC
CTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAG
GCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>Tet|tetA_P_1_AB054980|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
ATGGTTAATAAACTTTCAGCATATAAAACTTATTTATTATTTTCAGCTATTGCAGCAATGTGTTTTTCGTTAGTAGCTAC
AGTTATGGTAGTGTATCACATTGAAATAGTTCATTTAAATCCACTTCAACTTATACTTGTTGGAACTACTTTGGAATTAG
CATGCTTTATATTTGAAATTCCTACAGGTATAGTTGCAGATGTGTATAGTCGTAAACTATCTATTGTTATTGGGGGAGTT
TTAACAGGAGTGGGATTTATTTTAGAAGGTTCTATTTCTAGTTTTGTTTTCGTACTTGTAGCACAGATTGTATGGGGATT
AGGGTCTACTTTTATCAGTGGCTCGCTTGAAGCTTGGATTGCGGAAGAAGAGAAGAATAAAGATTTAGATGAAATTTATA
TAAAGGGAGCACAAGCAGGGCAGATAGGAGCATTTATTGGAATAGTACTAAGCACTGTAATAGCTAATTTCTCTGTAAGG
CTTCCTATTATAGTTAGTGGAGTTTTATTTATAATTCTTGCATTATTTTTATGGTTATATATGCCAGAAAATAATTTTAA
ACCATCTGCTCCTGGGGATTTAAATACATTCAAAAAGATGGTATATACATTTAAATCTGGTCTTAAAATTGTAAAAAGTA
AATCTATAATTATGATTTTACTTGCAGTAACTTTATTTTATGGATTATCAAGTGAAGGTTATGATAGACTTTCTAATGCG
CATTTTTTACAAGATACTACACTTCCTAAGCTTGGAAACCTTAGTTCAGTGACTTGGTTTGGAATTTTTGGAATTTTAGG
AATGATATTGAGCTTCATAGTAATGCATTTTATGGCAAAGAATCTTAAGAATGAGGATAATAGGAAAAATGGAAAACTAT
TATTATGTATAAATATACTTTATATATCGTCTATGTTGATATTTGCTCTTACAAAAAACTTTAGTTTAATGTTAATAGCT
TATTTGGCAACAAATACCTTTAGAATTATAAATGAACCTATATTCAGTGCGTGGTTAAATGGGCATATAGATGATAACTC
TAGAGCTACTGTACTTTCTATAAATGGACAAATGAATTCCTTAGGTCAAATTTTAGGTGGACCAATTATAGGAATCATAG
CTACAAATATTTCAGTAAGTATTGGTATAGCATGTACTTCGTTATTAGTAACACCGGTATTAGTGTTATATATTGTTGCT
ATGATAATTGATAAAAAGGTGGATGATAGAGTTGGAGGTATTGATTATGAAGAAAATAATTAA

>Tet|TetA|JX424423|94438-95712|1275|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
ATGTCCACCAACTTATCAGTGATAAAGAATCCGCGCGTTCAATCGGACCAGCGGAGGCTGGTCCGGAGGCCAGACGTGAA
ACCCAACAGACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGTGCTGC
CGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGTTGATG
CAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCGGTCTTGCTCGTCTCGCTGGCCGG
CGCTGCTGTCGACTACGCCATCATGGCGACGGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGGCATCA
CCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCGGCTTC
ATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCACGCTCC
GTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACAAAGGCGAAC
GCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCGCCCTG
ATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGCTTTCA
CTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCACCGGCC
CTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGCTTGCC
TTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTGCAAGC
AATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGACCTCGA
TCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAGGCGCT
GCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>254|AF090987.1|AF090987|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
ATGAACAAGGCCCTTATCGTTATTCTCTCAACCGTTGCCCTCGACGCCATTGGCGCAGGCCTGATCTTCCCGATCCTGCC
GGACATCTTGGTCGAGGTGACTGGCGGCGGCGACATCGGGTTCCTCTATGGGGTCATGCTGGGGGTATTCGCCGTCATGC
AATTTGTGTTCTCGCCGATCCTTGGTGCGCTCAGCGACCGGTTCGGTCGGCGCCCGGTCTTGTTGCTTTCTTTGGCCGGT
ACCCTGCTTGATTACCTTGTTATGGCATTTTCCCCGCTCGGCTGGGTGCTCGTCGTCGGGCGGGCCATGGCGGGGATCAC
CAGCGCAAATATGGCGGTGGCAAGCGCCTACATCACTGACATCACCCCAGCCGAGCAGCGCGCGCAGCGGTTTGGCACGG
TTGGTGCCGTGATGAGCCTGGGCTTTATCATCGGTCCCGTCATTGGTGGCGTCATTGGCGCCTGGTGGCTTCGGGCACCA
TTTCTTGTGGCAGCCCTGTTCAATGGCCTCAACCTGTTCGTCGCGCTGTTTGTTCTGCCGGAAAGCCGAAAGGCCGGTCC
GGGCAAGTTTGCGTTCAAGGAACTTAACCCGTTGGCGCCATTGGTGTGGCTTTGGAATTTCAAGCCGCTCCTGCCACTTG
TAACCGTCTCTGTCGTCTTCGGTCTGGTGGCCGCCATCCCGGGAACGATCTGGGTGCTCTATGGCGCCGAGCGGTTCGGA
TGGGATTCGGTGCATATGGGCCTGTCGCTATCGGTTTTCGGCGTCAGTGGCGCCCTGGCGCAGGCCTTTCTCGTCGGGCC
GCTCTCGCGCCGCTTTGGTGATTTGGGCACGTTGATGATCGGCGTTGGCTTTGACATGCTGGCTTATATGCTGATGGCCT
TCGCCAACCAGAGCTGGATGGGCTACGCGGTAGCGCCCCTGTTTGCATTGGGCGGCGTTGCCATGCCGGCGCTGCAATCT
CTGGTAACCAGCCGCGTGAGCGATGATCAGCAGGGCCAGTTGCAGGGCGTGCTCGCCAGCCTCATGAGCCTGGCGGGTAT
AATAGGGCCGGTGCTGACCACCGCAGTGTTCTTTTCCACCAAAAGCATCTGGATCGGGACGATCTGGCTGGTGGGTGCCG
CACTTTATCTTCTCGCCTTGCCGCTGTTCGCAACGGTGAAAACCCCGAAGGCTGTGGCGGCTTAA

>Tet|TetA-P|L20800|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
ATGGTTAATAAACTTTCAGCATATAAAACTTATTTATTATTTTCAGCTATTACAGCAATGTGTTTTTCGTTAGTAGCTAC
AGTTATGATGGTGTATCACATTGAAATAGTTCATTTAAATCCACTTCAGCTTATACTTGTTGGAACTACTTTGGAATTAG
CATGCTTTATATTTGAAATTCCTACAGCTATAGTTGCAGATGTGTATAGTCGTAAACTATCTATTGTTATTGGGGGAGTT
TTAACAGGAGTGGGATTTATTTTAGAAGGTTCTATTTCTAGTTTTGTTTTCGTACTTGTAGCACAGATTGTATGGGGATT
AGGGTCTACTTTTATCAGTGGCTCGCTTGAAGCTTGGATTGCGGAAGAAGAGAAGAATAAAGATTTAGATGAAATTTATA
TAAAGGGAGCACAAGCAGGGCAGATAGGAGCATTTATTGGAATAGTACTAAGCACTGTAATAGCTAATTTCTCTGTAAGG
CTTCCTATTATAGTTAGTGGAGTTTTATTTATAATTCTTGCATTATTTTTATGGTTATATATGCCAGAAAATAATTTTAA
ACCATCTGCTCCTGGGGATTTAAATACATTCAAAAAGATGGTATATACATTTAAATCTGGTCTTAAATTTGTAAAAAGTA
AATCTATAATTATGATTTTACTTGCAGTAACTTTATTTTATGGATTATCAAGTGAAGGTTATGATAGACTTTCTAATGCG
CATTTTTTACAAGATACTACACTTCCTAAACTTGGAAACCTTAGTTCAGTGACTTGGTTTGGAATTTTTGGAATTTTAGG
AATGATATTGAGCTTCATAGTAATGCATTTTATGGCAAAGAATCTTAAGAATGAGGATAATAGGAAAAATGGAAAACTAT
TATTATGCATAAATATACTTTATATATCGTCTATGTTGATATTTGCTCTTACAAGAAACTTTAGTTTAATGTTAATAGCT
TATTTGGCAACAAATACCTTTAGAATTATAAATAAACCTATATTCAGTGCGTGGTTAAATGGGCATATAGATGATAATTC
TAGAGCTACTGTGCTTTCTATAAATGGACAAATGAATTCCTTAGGTCAAATTTTAGGTGGACCGATTATAGGAATCATAG
CTACAAATATTTCAGTAAGTATTGGTATAGTATGTACTTCGTTATTAGTAACACCGGTATTAGTGTTATATATTGTTGCT
ATGATAATTGATAAAAAGGTGGATGATAGAGTTGGAGGTATTGATTATGAAGAAAATAATTAA

>260|unknown_id|unknown_name|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
TTGAAAAAACCCATGCTGGTTATTTTGTTGACGGTGTTGCTGGATGCGGTGGGCATCGGTCTGATCATGCCTATTCTACC
GGCGCTGTTGCGCTCGCTGGGCGGTCTCGATGCCGGCAGCGTGCATTACGGCGCCCTGCTGGCGGCCTATGCGTTGATGC
AATTCCTGTTTTCGCCGATCCTCGGCGCGCTGAGCGATCGTTTCGGGCGGCGGCCGGTGCTGTTGATTTCGCTCGCCGGC
GCGGCGGCCGACTACCTGCTGATGGCGTTCGCGCCGACGCTGGCCTGGCTCTATCTGGGGCGGTTGCTGGCGGGCATCAC
CGGCGCCAACATGGCGGTCGCCACCGCTTACGTCACCGATATTACCCCCGTCGGCCAGCGCGCTCGGCGTTTCGGCCTGG
TGGGCGCGGTGTTCGGCGTCGGCTTTATCGTCGGCCCGCTGCTCGGCGGATCGCTGGGCGAATGGCATCTGCATGCGCCC
TTCCTGGCGGCGGCGATGATGAATGCCCTCAACCTGGTGATGGCGTTTTTCCTGCTGCCCGAATCGCGTAAATCCCGCCC
CCGCGCCGCCGAGAAAATTCGCCTTAATCCCTTCTCGTCATTGCGCCGGCTGCACGGCAAGCCTGGCCTGCTGCCGCTGG
CCGGCATTTATCTGGTTATGGCGCTGGTTTCGCAGGCGCCGGCCACGCTGTGGATTTTATACGGTCAGGATCGTTTCGGC
TGGAGCATGATGGTGGCGGGCCTGTCGCTGGCCGGCTACGGCGCCTGCCACGCGCTGTCGCAGGCCTTTGCCATCGGCCC
GCTGGTCGCGCGGCTCGGCGAGCGCAAGGCGCTGCTGATCGGCCTGGCCGCCGACGCCGTGGGCCTGGCGCTGTTGTCTG
TCGCCACGCGCGGCTGGGCGCCGTTCGCCCTGCTGCCGTTCTTCGCCGCGGGCGGCATGGCGTTGCCCGCACTGCAGGCG
CTGATGGCGCACAAGGTGGACGACGATCATCAGGGCGAGCTGCAAGGGACGCTCGCCAGCATGGGCAGCCTGATCGGCGT
CGCGGGGCCGCTGGTGGCGACGGCGCTGTATGCCGCCACGCGCGATGTCTGGCCTGGGCTGGTGTGGGCGTTGGCCGCCG
CCCTGTACCTGGTGGTGCCGCCGCTGCTGGCACGCTCACGCGCCAGGGATGCGGCGCCATAA

>201|EU523697.1|EU523697|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
ATGACTTCACCCACCTCTCTCACGCGACGGGACCAGAACCGCGCGTGGATCATGCTCATCGTGCTCACGATGCTCACCGT
CATCGGAATGACGGTCGTCCTCCCGGTCCTGCCCTTCGTCGTGCTCCAGTACGTCTCGCACGAGAGCGACCTGGCCATCT
GGGTCGGCGTGCTCGAAGCGATCAACGGCCTCTGCGCCTTCCTGGTCGCGCCCTTCCTCGGACGTCTCTCAGACCGCTTC
GGACGTCGACCCGTGATCATCGTCGCGGCATTCGGTGCGGCCTTCTCGATGGCGCTGTTCGGATTCGGCGGCGCCCTCTG
GGTGCTCGTGCTCGCTCGCGTCATCCAGGGCCTCACCGCGGGCGATCTACCCGCCCTCTTCGCCTACCTGGCCGACATCA
CCCCGCCGGAGCAGCGCGCCAAGCGCTTCGGCCTCCTCGGTGCGCTCTCGGGGATCGGCACCATGATCGGTCCAGCCATC
GGAGGACTGCTCGCCGCGATCAGCATCCAGCTCCCGGTGTTCCTGACCGCCGCCGTCGCCCTCACGATCGCGATCCTCAG
CATCTTCCTCCTCCCGGAGAGCCTGAAGCCGGGCAACAGGATCACCGCGATCAAGCTGCGCGACGTGCAGCCCTTCGCCG
TCTTCAAGGAGGCCTTCGGACGCAAGGAGCTGCGCGGGCTGATGATCGGCTTCGGCCTGCTCGCGCTGCCGTTCGGCTTC
TTCGTGAACAACTTCAGCGTGCTCGCCCTGGACTCCATCCAGTGGGGACCGACCCAGATCGGACTCCTGACCGCGGCCGT
CGGCATCATCGACATCCTCATCCAGGGCGTGCTGCTGGGCATCCTGCTTCCGCGCATCGGCGAGCGCGGAGTGATCGTGA
GCGGCATCGTCGCGCAGATGATCGGTCTCGCGGCCCTCGCCGTCGTGGCTTCCGTCTTCGCGCAGCCGTGGGTGTTCATC
GTCGGCGCCCTGATGCTGGCCGCCGGCCAGGGGGCGTCCCAGGCCGCGATGGACGGGGCGATGTCCAACGCCGTCGGCGA
CGACGAGCAGGGCTGGCTCGGCGGAGCCACCCAGTCGTTGAATGCGGCGATGGGCACGGCAGCCCCGCTCATCGCCGGTG
CGCTCTACGCACTGGTCAGCCACGCGGCCCCGTACTGGCTCGGGGTCGCGCTCATGATCGTGGCGGTGACCGTCGTCAGC
CGCGCGCACATCGCGAACACCGCGAAGCGCCCGGCCGGCGAGACGACGGGCGACGCTCCCGCGGCACTCGTGGAGACGGC
TGGCTGA

>Tet|tetA_5_AJ419171|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
GTGAAACCCAACAGACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGT
GCTGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGT
TGATGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCGGTCTTGCTCGTCTCGCTG
GCCGGCGCTGCTGTCGACTACGCCATCATGGCGACGGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGG
CATCACCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCG
GCTTCATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCAC
GCTCCGTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACATTGG
CGAACGCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCG
CCCTGATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGC
TTTCACTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCAC
CGGCCCTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGC
TTGCTTTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTG
CAAGCAATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGAC
CTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAG
GCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>Tet|tetA_3_AY196695|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
GTGAAACCCAACATACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGT
GCTGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGT
TGGTGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCAATCTTGCTCGTCTCGCTG
GCCGGCGCCACTGTCGACTACGCCATCATGGCGACAGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGG
CATCACCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCG
GCTTCATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCAC
GCTCCGTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACAAAGG
CGAACGCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCG
CCCTGATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGC
TTTCACTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCAC
CGGCCCTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGC
TTGCCTTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTG
CAAGCAATGTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGAC
CTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAG
GCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>Tet|tetA_2_X00006|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
GTGAAACCCAACATACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGT
GCTGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGT
TGGTGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCAATCTTGCTCGTCTCGCTG
GCCGGCGCCACTGTCGACTACGCCATCATGGCGACAGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGG
CATCACCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCG
GCTTCATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCAC
GCTCCGTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACAAAGG
CGAACGCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCAGCTTCGTTCGGTGGGCCCGGGGCATGACCGTCGTCGCCG
CCCTGATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGC
TTTCACTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCAC
CGGCCCTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGC
TTGCCTTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTG
CAAGCAATGTTGTCCAGGCAGGTGGATGAGGAACGCCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGAC
CTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAG
GCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>Tet|tetA_6_AJ313332|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
GTGAAACCCAACAGACCCCTGATCGTAATTCTGAGCACTGTCGCGCTCGACGCTGTCGGCATCGGCCTGATTATGCCGGT
GCTGCCGGGCCTCCTGCGCGATCTGGTTCACTCGAACGACGTCACCGCCCACTATGGCATTCTGCTGGCGCTGTATGCGT
TGATGCAATTTGCCTGCGCACCTGTGCTGGGCGCGCTGTCGGATCGTTTCGGGCGGCGGCCGGTCTTGCTCGTCTCGCTG
GCCGGCGCTGCTGTCGACTACGCCATCATGGCGACGGCGCCTTTCCTTTGGGTTCTCTATATCGGGCGGATCGTGGCCGG
CATCACCGGGGCGACTGGGGCGGTAGCCGGCGCTTATATTGCCGATATCACTGATGGCGATGAGCGCGCGCGGCACTTCG
GCTTCATGAGCGCCTGTTTCGGGTTCGGGATGGTCGCGGGACCTGTGCTCGGTGGGCTGATGGGCGGTTTCTCCCCCCAC
GGTCCGTTCTTCGCCGCGGCAGCCTTGAACGGCCTCAATTTCCTGACGGGCTGTTTCCTTTTGCCGGAGTCGCACAAAGG
CGAACGCCGGCCGTTACGCCGGGAGGCTCTCAACCCGCTCGCTTCGTTCCGGTGGGCCCGGGGCATGACCGTCGTCGCCG
CCCTGATGGCGGTCTTCTTCATCATGCAACTTGTCGGACAGGTGCCGGCCGCGCTTTGGGTCATTTTCGGCGAGGATCGC
TTTCACTGGGACGCGACCACGATCGGCATTTCGCTTGCCGCATTTGGCATTCTGCATTCACTCGCCCAGGCAATGATCAC
CGGCCCTGTAGCCGCCCGGCTCGGCGAAAGGCGGGCACTCATGCTCGGAATGATTGCCGACGGCACAGGCTACATCCTGC
TTGCCTTCGCGACACGGGGATGGATGGCGTTCCCGATCATGGTCCTGCTTGCTTCGGGTGGCATCGGAATGCCGGCGCTG
CAAGCAATTTTGTCCAGGCAGGTGGATGAGGAACGTCAGGGGCAGCTGCAAGGCTCACTGGCGGCGCTCACCAGCCTGAC
CTCGATCGTCGGACCCCTCCTCTTCACGGCGATCTATGCGGCTTCTATAACAACGTGGAACGGGTGGGCATGGATTGCAG
GCGCTGCCCTCTACTTGCTCTGCCTGCCGGCGCTGCGTCGCGGGCTTTGGAGCGGCGCAGGGCAACGAGCCGATCGCTGA

>1388|HQ399624.1|HQ399624|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
TGGATTGCGGAGGAAGAGAAGAATAAAGATTTAGATGAAATTTATATAAAGGGAGCACAAGCAGGGCAGATAGGAGCATT
TATTGGAATAGTACTAAGCACTGTAATAGCTAATTTCTCTGTAAGGCTTCCTATTATAGTTAGTGGAGTTTTATTTATAA
TTCTTGCATTATTTTTATGGTTATATATGCCAGAAAATAATTTTAAACCATCTGCTCCTGGGGATTTAAATACATTCAAA
AAGATGGTATATACATTTAAATCTGGTCTTAAAATTGTAAAAAGTAAATCTATAATTATGATTTTACTTGCAGTAACTTT
ATTTTATGGATTATCAAGCGAAGGTTATGATAGACTTTCTAATGCACATTTTTTACAAGATACTACACTTCCTAAGCTTG
GAAACCTTAGTTCAGTGACTTGGTTTGGAATTTTTGGAATTTTAGGAATGATATTGAGCTTCATAGTAATGCATTTTATG
GCAAAGAATCTTAAGAATGAGGATAATAGGAAAAATGGAAAACTATTATTATGTATAAATATACTTTATATATCGTCTAT
GTTGATATTTGCTCTTACAAAAAACTTTAGTTTAATGTTAATAGCTTATTTGGCAACAAATACCTTTAGAATTATAAATG
AACCTATATTCAGTGCGTGGTTAAATGGGCATATA

>Tet|tetA_P_4_AB001076|Tetracyclines|Tetracycline_resistance_major_facilitator_superfamily_MFS_efflux_pumps|TETA
ATGGTTAATAAACTTTCAGCATATAAAACTTATTTATTATTTTCAGCTATTGCAGCAATGTGTTTTTCGTTAGTAGCTAC
AGTTATGGTAGTGTATCACATTGAAATAGTTCATTTAAATCCACTTCAACTTATACTTGTTGGAACTACTTTGGAATTAG
CATGCTTTATATTTGAAATTCCTACAGGTATAGTTGCAGATGTGTATAGTCGTAAACTATCTATTGTTATTGGGGGAGTT
TTAACAGGAGTGGGATTTATTTTAGAAGGTTCTATTTCTAGTTTTGTTTTCGTACTTGTAGCACAGATTGTATGGGGATT
AGGGTCTACTTTTATCAGTGGCTCGCTTGAAGCTTGGATTGCAGAAGAAGAGAAGAATAAAGATTTAGATGAAATTTATA
TAAAGGGAGCACAAGCAGGGCAGATAGGAGCATTTATTGGAATAGTACTAAGCACTGTAATAGCTAATTTCTCTGTAAGG
CTTCCTATTATAGTTAGTGGAGTTTTATTTATAATTCTTGCATTATTTTTATGGTTATATATGCCAGAAAATAATTTTAA
ACCATCTGCTCCTGGGGATTTAAATACATTCAAAAAGATGGTATATACATTTAAATCTGGTCTTAAAATTGTAAAAAGTA
AATCTATAATTATGATTTTACTTGCAGTAACTTTATTTTATGGATTATCAAGTGAAGGTTATGATAGACTTTCTAATGCA
CATTTTTTACAAGATACTACACTTCCTAAGCTTGGAAACCTTAGTTCAGTGACTTGGTTTGGAATTTTTGGAATTTTAGG
AATGATATTGAGCTTCATAGTAATGCATTTTATGGCAAAGAATCTTAAGAATGAGGATAATAGGAAAAATGGAAAACTAT
TATTATGTATAAATATACTTTATATATCGTCTATGTTGATATTTGCTCTTACAAAAAACTTTAGTTTAATGTTAATAGCT
TATTTGGCAACAAATACCTTTAGAATTATAAATGAACCTATATTCAGTGCGTGGTTAAATGGGCATATAGATGATAACTC
TAGAGCTACTGTACTTTCTATAAATGGACAAATGAATTCCTTAGGTCAAATTTTAGGTGGACCAATTATAGGAATCATAG
CTACAAATATTTCAGTAAGTATTGGTATAGCATGTACTTCGTTATTAGTAACACCGGTATTAGTGTTATATATTGTTGCT
ATGATAATTGATAAAAAGGTGGATGATAGAGTTGGAGGTATTGATTATGAAGAAAATAATTAA